Busch Lab

ZMP

fabp11b

Ensembl ID:
ENSDARG00000002311
ZFIN ID:
ZDB-GENE-050522-391
Description:
fatty acid binding protein 11b [Source:RefSeq peptide;Acc:NP_001018394]
Human Orthologues:
FABP12, FABP4, FABP5, FABP9, PMP2
Human Descriptions:
fatty acid binding protein 12 [Source:HGNC Symbol;Acc:34524]
fatty acid binding protein 4, adipocyte [Source:HGNC Symbol;Acc:3559]
fatty acid binding protein 5 (psoriasis-associated) [Source:HGNC Symbol;Acc:3560]
fatty acid binding protein 9, testis [Source:HGNC Symbol;Acc:3563]
peripheral myelin protein 2 [Source:HGNC Symbol;Acc:9117]
Mouse Orthologues:
Fabp12, Fabp4, Fabp5, Fabp9, Pmp2
Mouse Descriptions:
fatty acid binding protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922747]
fatty acid binding protein 4, adipocyte Gene [Source:MGI Symbol;Acc:MGI:88038]
fatty acid binding protein 5, epidermal Gene [Source:MGI Symbol;Acc:MGI:101790]
fatty acid binding protein 9, testis Gene [Source:MGI Symbol;Acc:MGI:1194881]
peripheral myelin protein 2 Gene [Source:MGI Symbol;Acc:MGI:102667]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42690 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012718 Essential Splice Site 117 134 3 4
Genomic Location (Zv9):
Chromosome 16 (position 18201511)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16242748
GRCz11 16 16150725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGACCACAATAATCGAAAGAGAGATTCAAGACACGAAAATGATAGCGG[T/A]ATGTGTACAAGCCTCATGCAGTTAGCTTTATATCGCTAAGCTGCAGTTTT
Associated Phenotype:
Not determined