Busch Lab

ZMP

arsh

Ensembl ID:
ENSDARG00000002299
ZFIN ID:
ZDB-GENE-081104-120
Human Orthologues:
ARSD, ARSE, ARSF, ARSH
Human Descriptions:
arylsulfatase D [Source:HGNC Symbol;Acc:717]
arylsulfatase E (chondrodysplasia punctata 1) [Source:HGNC Symbol;Acc:719]
arylsulfatase F [Source:HGNC Symbol;Acc:721]
arylsulfatase family, member H [Source:HGNC Symbol;Acc:32488]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41563 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032992 Nonsense 98 587 3 11
ENSDART00000134212 None None 479 None 7
Genomic Location (Zv9):
Chromosome 9 (position 57806389)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56237932
GRCz11 9 55588473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCGGCCGCTCCACTCTGCACACCCAGCAGAACTGCCTTCATGACGGGA[C/T]GATACCCTCTGCGCGCCGGTCAGAGAACAAACATCGTCTGCCTCACATAA
Associated Phenotype:
Not determined