Busch Lab

ZMP

EPB41L3 (2 of 2)

Ensembl ID:
ENSDARG00000002255
Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Human Orthologue:
EPB41L3
Human Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Mouse Orthologue:
Epb4.1l3
Mouse Description:
erythrocyte protein band 4.1-like 3 Gene [Source:MGI Symbol;Acc:MGI:103008]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa14659 Essential Splice Site Available for shipment Available now
sa44206 Nonsense Mutation detected in F1 DNA Not yet available
sa44205 Nonsense Mutation detected in F1 DNA Not yet available
sa37970 Nonsense Mutation detected in F1 DNA Not yet available
sa25219 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Essential Splice Site 142 821 8 26
ENSDART00000130310 Essential Splice Site 142 825 8 27
Genomic Location (Zv9):
Chromosome 24 (position 43686740)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42087133
GRCz11 24 41955738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATGAGTCTCTGAACACTGAGTCGCGATTCACCTGAACGATTCCTTTC[A/T]GAACTKGCTGGATCCTGCCAAAGACATGAAGAAGCAGATCCGAGGTGACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30163
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 177 821 9 26
ENSDART00000130310 Nonsense 177 825 9 27
Genomic Location (Zv9):
Chromosome 24 (position 43686547)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42086940
GRCz11 24 41955931
KASP Assay ID:
2261-9177.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTCTCCTTCAACGTCAAGTTTTACCCTCCAGAGCCGGCGCTGCTGTCT[G/T]AAGACATCACCAGGTCAGACTCACACACTTCACTTCTGGAGTTATTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44206
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 302 821 14 26
ENSDART00000130310 Nonsense 302 825 14 27
Genomic Location (Zv9):
Chromosome 24 (position 43679947)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42079049
GRCz11 24 41963822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGTGTGGAGATCATGCTGGGCGTGTGTTCGTCAGGCCTCCTCATCTA[C/A]AGAGACAGACTCCGCATCAACCGATTCGCCTGGCCTAAAGTGCTGAAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4274
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Essential Splice Site 334 821 14 26
ENSDART00000130310 Essential Splice Site 334 825 14 27
Genomic Location (Zv9):
Chromosome 24 (position 43679849)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42078951
GRCz11 24 41963920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCTCCTACAAACGCAATAACTTCTACATCAAGATCCGCCCCGGAGAGG[T/G]GAGAGCGCCWTCTGCTGTACACGGCTCACATTTACTGAACTCTGCATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44205
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 396 821 16 26
ENSDART00000130310 Nonsense 396 825 16 27
Genomic Location (Zv9):
Chromosome 24 (position 43678576)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42077678
GRCz11 24 41965193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTCTGGGCTCTAAGTTCCGCTACAGCGGCCGGACGCAGGCTCAAACC[A/T]GACGCGCCAGCTCACAGATCGTGCGGCCCGCACCCTACTTCCAGCGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37970
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 504 821 17 26
ENSDART00000130310 Nonsense 504 825 17 27
Genomic Location (Zv9):
Chromosome 24 (position 43674029)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42073131
GRCz11 24 41969740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTGCTGGTGGAGAACGTGATGATTCTGGAGGACGACGACGAAACCACC[A/T]GAGCCACAGAGCTGTCACTGCCCAGCCCAGCAACACCAGCCCGCCTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25219
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 753 821 24 26
ENSDART00000130310 Nonsense 757 825 25 27
Genomic Location (Zv9):
Chromosome 24 (position 43662596)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42061502
GRCz11 24 41981369
KASP Assay ID:
554-7707.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACATAAAGACACTCACACTCTGGCAAACATACACACACTCATACATAT[A/T]GACATACTCTCATATGCATGCACGTACACACACACACTCCCAGACAAACA
Associated Phenotype:
Not determined