Busch Lab

ZMP

tbxas1

Ensembl ID:
ENSDARG00000002249
ZFIN ID:
ZDB-GENE-030131-8805
Description:
thromboxane-A synthase [Source:RefSeq peptide;Acc:NP_991172]
Human Orthologue:
TBXAS1
Human Description:
thromboxane A synthase 1 (platelet) [Source:HGNC Symbol;Acc:11609]
Mouse Orthologue:
Tbxas1
Mouse Description:
thromboxane A synthase 1, platelet Gene [Source:MGI Symbol;Acc:MGI:98497]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9271 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36591 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9271
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047555 Essential Splice Site 65 546 3 16
ENSDART00000109497 Essential Splice Site 65 546 2 13
ENSDART00000144246 Essential Splice Site 65 546 3 14
Genomic Location (Zv9):
Chromosome 18 (position 12153168)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12735897
GRCz11 18 12704615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACACCCAAAGCCCTTGCCATTTATTGGGAACCKGATGATGTTCCGAAAC[G/A]TAAGAATTTWGGTTATTTTATGAAGCACAAAAGTCATTCTCTCCTATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36591
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047555 Nonsense 80 546 4 16
ENSDART00000109497 Nonsense 80 546 3 13
ENSDART00000144246 Nonsense 80 546 4 14
Genomic Location (Zv9):
Chromosome 18 (position 12174112)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12756841
GRCz11 18 12725559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCACAGGGTTTCTTTAAGTCTCAAGCTGACCTCATAAACAAGTACGGA[C/T]GAATTTGTGGGTAAGTCTCTTTTGATTGTACTCACAGTTATCAAACTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28993
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047555 Essential Splice Site 83 546 5 16
ENSDART00000109497 Essential Splice Site 83 546 4 13
ENSDART00000144246 Essential Splice Site 83 546 5 14
Genomic Location (Zv9):
Chromosome 18 (position 12184604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12767333
GRCz11 18 12736051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTTGTTTGTTTGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTAA[G/T]TTATTATATAGGCCGGCGGTCTACAGTGATCATAGCGGACCCGGATATGC
Associated Phenotype:
Not determined