Busch Lab

ZMP

stk25a

Ensembl ID:
ENSDARG00000002210
ZFIN ID:
ZDB-GENE-041010-92
Description:
serine/threonine kinase 25a [Source:RefSeq peptide;Acc:NP_001005925]
Human Orthologue:
STK25
Human Description:
serine/threonine kinase 25 [Source:HGNC Symbol;Acc:11404]
Mouse Orthologue:
Stk25
Mouse Description:
serine/threonine kinase 25 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1891699]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127418 Nonsense 85 424 2 11
Genomic Location (Zv9):
Chromosome 6 (position 26763584)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27064795
GRCz11 6 27055356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCTCAGCCAGTGCGACAGCCCTTATGTCACCAAATACTATGGATCCTA[T/A]CTGACGGTTKGTGGAWATTTMATTATTTTGGCAACTGCTTTTAAAATATC
Long Flanking Sequence:
TTCTTGTTTTTGTTGTGTTCAACAAGGAAACAGATGCTCGATGTGTTCTCCTTGAGTCAAAAAATGAAAAAATTGCTTAAAAAACTGCACAGGATTTCTGATGGTTCAATCTATAGATACTCTTCTTCTTCAGATCTGTATTCCAGCGATGATTGGGTAGATGTTGATTTGTTGCTTTGGTAATAATAGAGCAGTCACCTGTGTGAAGAAGATGAACAGTGTTGAGTGATGTCATAGATTAATTTAAGTATTTGTTCTTGTGTTAATTTGTTTCAGAACTCACGTTTAAATCCTGAGGAATACTTCACCAAATTGGAGCGCATCGGTAAAGGCTCTTTTGGAGAGGTTTATAAGGGCATAAACAACCGCACCAAAGAGGTTGTTGCCATTAAGATCATTGACTTGGAAGAAGCAGAAGATGAGATTGAAGACATCCAGCAGGAGATCACAGTGCTCAGCCAGTGCGACAGCCCTTATGTCACCAAATACTATGGATCCTA[T/A]CTGACGGTTGGTGGATATTTAATTATTTTGGCAACTGCTTTTAAAATATCATCTCATCTCATGTTTTTTTTCATAAATAATTCACCCAAATGAAAGCATTTGAAAAAAAAAAAAAAAAAAAACATGACTTCCTGAAAGCACTTTCCAATAACATGAAAGGGATATTTCACCCAAAAGGTCTTCAGTAGTTCTTCCTTTGTGTTCAACAGAAGAAACTCAAACAGGTTTGGAGCAGTGTATGGTGAGTAAATGATGACAGATTTCATTTTTGGGTGATCTATCCCTTGATTTAGCTCATGCACCAAGTATCATGAACTAAAAATTGACGTTAAGATAGACAAAAATGTAGTAACTCCTGCAAACATTATGTTAATAAGTAACAGTTGCCTACTAATATTACTTTCTGGCTCACATGTCCTTCCAAACCCACCAGGCTTTCATTTATCTTTAGAACATAGACATTTTTATGAAACCAGAGGTATTTCAGCCTCTTAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2287
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127418 Nonsense 97 424 3 11
Genomic Location (Zv9):
Chromosome 6 (position 26761935)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27063146
GRCz11 6 27053707
KASP Assay ID:
554-2554.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGGTTTATTGTTTCTCAGGGYTCTAAACTATGGATCATCATRGAATA[T/A]CTGGGAGGTGGATCCGCTCTGGATCTGGTGAGTTGGCTTTTTCRTCAYAT
Long Flanking Sequence:
GACTCTCCATGTTTAATTTTGTTTTTATATACACAATTATGCAGTCAAACTGTTGTATAAACGCAATATCACACTCGTAGCAGTGCGATATGGCTGTATATCTGCACTGATGGAGGCACTAATGCACTCGGCCTGCGGCCTCTTGCCAACGCACGCCTCCCACCAGTGCCGATATACAGCCATATCGCACTGCTACTCGTGTGATATTGCTCATATATATAACATATACACACTCACACACATAATTCAATTCAATAGTCATTTGATAAAAAAAAACAAAGTACTAATTTTTTTTTTATTTAAAGCAAAAATGTTTAAAAAAATGCAGCCCATTTAAAACATTATTCCAAAATAATATTATTATAAAATAATATATATAATAATAAATACCAAAATAAAAGACAAAACAGAAGTGATGATTAAACGTACATTGTTTATACAAATTTTATTTTGTGGTTTATTGTTTCTCAGGGTTCTAAACTATGGATCATCATGGAATA[T/A]CTGGGAGGTGGATCCGCTCTGGATCTGGTGAGTTGGCTTTTTCGTCACATTTGTGTTTTTTTTCTAAAGCTATTGAAAATAGCAAAATCACCTTTACTTAACATGTCTAATTTTTTTGATTTTAGCTCAGACCTGGAACTTTGGAAGAGGTGTATATTGCCACCATCCTCAGAGAAATACTAAAAGGACTCGACTACCTGCACTCAGAGAGGAAGATTCACAGAGACATCAAAGGTGAACACTTTAAATTTGCTTCTGTTTTGTAATTGAAAATGTATTCACAATTTCCTCGCCCTAAAGTGGTACCAGTGGAACATTTGTTTGTTTTTTATTGAACACATAAGACAATATTTTGAAGAATGCTGGAAACTGGTAAACATTGACATGCATACAGACAAACAAATACCATGGAAGTCCATGTTCCTACATTCTTCATTCTTTTGTGTTCATTAGAATAAAGAAACTCATACAGGTTTGGAAACATGAAGGAAGAGTAAATA
Associated Phenotype:
Not determined