Busch Lab

ZMP

PYGL

Ensembl ID:
ENSDARG00000002197
Description:
phosphorylase, glycogen, liver [Source:HGNC Symbol;Acc:9725]
Human Orthologue:
PYGL
Human Description:
phosphorylase, glycogen, liver [Source:HGNC Symbol;Acc:9725]
Mouse Orthologue:
Pygl
Mouse Description:
liver glycogen phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97829]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa16886 Nonsense Available for shipment Available now
sa6325 Nonsense Mutation detected in F1 DNA Not yet available
sa12138 Nonsense Available for shipment Available now
sa38964 Missense Mutation detected in F1 DNA Not yet available
sa38963 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4520
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 109 965 2 31
Genomic Location (Zv9):
Chromosome 13 (position 37263339)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36735641
GRCz11 13 36861473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTCGCACGCTCCAGAACACCATGATCAATCTGGGTCTGCAGAAYGCCTG[T/A]GATGAGGCCATCTATCAGGTCAGGGAACACAAAAACACTCATTTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16886
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 161 965 4 31
Genomic Location (Zv9):
Chromosome 13 (position 37263010)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36735312
GRCz11 13 36861144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTAGACTCAATGGCRACTCTGGGTCTGGCAGCCTATGGATATGGGATA[C/T]GATATGAATATGGAATATTCAACCAGAAGATTAAAGATGGCWGGCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 264 965 7 31
Genomic Location (Zv9):
Chromosome 13 (position 37259199)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36731501
GRCz11 13 36857333
KASP Assay ID:
554-5215.1 (used for ordering genotyping assays)
KASP Sequence:
TTAWAAATTCTTTATAAACTSTATTTATTTACAGTTAAYGTGGGTGATTA[C/A]ATTCAGGCAGTTTTGGACCGTAACTTAGCAGAAAACATTTCSCGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12138
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 387 965 10 31
Genomic Location (Zv9):
Chromosome 13 (position 37256148)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36728450
GRCz11 13 36854282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACRTTTGCYTACACAAACCACACGGTTCTGCCAGAGGCTCTGGAACGCTG[G/A]CCAGTTGATCTGATGGAGAAACTCTTACCGCGACACCTGCAGATCATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38964
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Missense 542 965 16 31
Genomic Location (Zv9):
Chromosome 13 (position 37253760)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36726062
GRCz11 13 36851894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGAATACAAACGGCAGCTGCTCAACTGCCTCCACGTCATCACCATGTA[C/A]AACCGTATGTATGCTACACAAACATAAACACACACTTGCGTTTTTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38963
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 956 965 31 31
Genomic Location (Zv9):
Chromosome 13 (position 37248820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36721122
GRCz11 13 36846954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCCACTGACCTGAAGATTCCTCCACCAGGCGAACCTCGTGAAGCTCTA[G/T]AGGAAACTGCACGCTCCCTGCGCAAGACCTGAAGACAAGATCATCAGATC
Associated Phenotype:
Not determined