Busch Lab

ZMP

rhd

Ensembl ID:
ENSDARG00000002194
ZFIN ID:
ZDB-GENE-051213-1
Description:
Rh blood group, D antigen [Source:RefSeq peptide;Acc:NP_001019990]
Human Orthologues:
RHCE, RHD
Human Descriptions:
Rh blood group, CcEe antigens [Source:HGNC Symbol;Acc:10008]
Rh blood group, D antigen [Source:HGNC Symbol;Acc:10009]
Mouse Orthologue:
Rhd
Mouse Description:
Rh blood group, D antigen Gene [Source:MGI Symbol;Acc:MGI:1202882]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42292 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42292
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020663 Essential Splice Site 53 423 None 10

The following transcripts of ENSDARG00000002194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 46143014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45385922
GRCz11 13 45522826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGTACAGAAGGTCTGAAAGTGAGCCCTTCGTCCACTCATATGCAGG[T/C]CAGTAAGTCTGAATTACAGTAAGGATTTGTTATGAATCTTTTAAAACCTG
Long Flanking Sequence:
TATTTAACAATTTTTTTTTTGCATTTAATAAATGTCCCCTTGATGAACAGAGTAATTTAAAATATAATAATAACAAATAAACAAAAACTGACCCCAAACTTTTGACCGGTAGTGTATATGTATGACTTTAGGATCTGTGTCACTCACACAAGGAGGATCTTATTTTGTGGTCATATAAAAGACTGAAAGCTGAATGCAAATTTTCTAATAACCCAAAGAGTGAAGGCTTTTTTTTTTTGGGGGGGGGGGGGGGGGGGGGGCACCTCTTACACACGTGATCCTCCATGTTCGTCATCTCTGGCCGGGTGAGATTACAGACATTCAGAGTTGGTCTCAGTAATAATGGCTCCTCAATACGCCCCCAGTCTCCGCTCAAGACTTCCTCTGGTGGCCTTCCTGCTGGAAACCCTCTTTCTCCTACTGTTTGTCTTTTGGGTGAAAATAGAGAAGCAAGAGTACAGAAGGTCTGAAAGTGAGCCCTTCGTCCACTCATATGCAGG[T/C]CAGTAAGTCTGAATTACAGTAAGGATTTGTTATGAATCTTTTAAAACCTGCAAACGTGTGTTTTTTTCATGGACAAAGTTTATAATCGTGTTATTTTCTGCTCACCTGCAACAGTAGCCCAAATCTTTTTTATTTAAAGAGAAAATTAGCCTTAGCATTGTGCAAATGACAAAAAAATAATACTAGGTTTGATATATTTACAGTAGGAAATGTACAAAATGTCCTCATGTAACATGATCTTTATATTTAATGATTTTTTTGGCATAAAAAATAATAATTTTTACCCATACAATTACTTTTTTTTTTTTTTGCAATTGCTAAAAATATACCAGAATGACATTATTTTTTGTCACAATAAGAATATAAAAAACAAACAAGCTTGTTAATATTTTACTAACAGACCATCAAATTCCTTAAAAAATAACACAGTGCCGCATCTTTCTAAATTAATTTATTTAATTTAATACCCCCTGAAGTTTAATTCTAAATCTCAGGTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28199
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020663 Nonsense 349 423 7 10

The following transcripts of ENSDARG00000002194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 46130552)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45373460
GRCz11 13 45510364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACACCTGCGGCGTCCTCAATGTTCACACTATACCTGGAATTCTGGGATG[G/A]TTTGCACATTTATGTCTACGGCTGGCCAGTATGGAAGGCACAGTGTAAGA
Long Flanking Sequence:
GCTGGAAGGGCATCCGCTGCGTAAAAACCTGCTGGATAAGTTGGCAGTTCATTCCGCTGTGGTGACCCCGGATTAATAAAGGGACTAAGCCGACAAGAAAATGAATGAATAATGATGGCTTGTTCTGCCGACAATTGAAAAAAAAAAAAGATATTGCTTAAGAGGGCTAATCATTTTGACCTTAAAATGGTTTCAAAAAAATTCAAACTGCTTTTATTCTAGCTGAATTAAGACAAGTAAGACTTTCTCCAGAAGAAAAAATATCATTAGACATACTGTGAAGATTTCCTTGCTCTGTTAAACTTCATCTGGGAAATATTTGATAGAAAAAAAAATAATTCACACCAGGGCTGATAATTTTGTCTTCAACCATATATAAAGAACTAAAAGCAATGATTTCTGCTGTTCTCTTTCACTCAGAATCACATGCTGTTTGCTTTTGAGTGTCACGACACCTGCGGCGTCCTCAATGTTCACACTATACCTGGAATTCTGGGATG[G/A]TTTGCACATTTATGTCTACGGCTGGCCAGTATGGAAGGCACAGTGTAAGATAACTTTCACTCTTAACCAATAAAATTATACACTTTATTAGGTACACCTGTCCAATTGCTTGTAACGCACATTTCTAATCAGCCAATCACATGGCAGCAACTCAATGCATTTAGGCATGTAGAAATGGTCAAGACAATCTGCTGCAGTTGGGAGAGGAAAGGTGATTCAAGTGACTTTGAACATGGCATGGTTGTTGGTGCCAGGCGTGCTGGTTTGAGTATTTCAGAAACTGCTGATCTACTGGGATTTTCACACACAACCATATCTATGGTTTAAAGAGAATGGTCAGAAGAAGAGAAAATATTCAGTGAGCGGCAGTTCTGTGGGCACAAGTGCCTTGTTGATGTCAGAGGAGAATGACCAGACTTGTTCCAGCTGATAGAAAGAGAAAAGTTACGCAAATAAGCAGTCGTTACAACCGATGTCTGCAGAGGAGCATATTTGAACAC
Associated Phenotype:
Not determined