Busch Lab

ZMP

tra2b

Ensembl ID:
ENSDARG00000002168
ZFIN ID:
ZDB-GENE-040426-1094
Description:
transformer-2 protein homolog beta [Source:RefSeq peptide;Acc:NP_957491]
Human Orthologue:
TRA2B
Human Description:
transformer 2 beta homolog (Drosophila) [Source:HGNC Symbol;Acc:10781]
Mouse Orthologue:
Tra2b
Mouse Description:
transformer 2 beta homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27355
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021266 Essential Splice Site 251 278 6 8

The following transcripts of ENSDARG00000002168 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 12858160)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12610725
GRCz11 9 12581928
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAACGTGGATATGATCGCTATGAAGACAGAGACTACTACAACAACAGG[T/G]CATACAGCTGACCCTTACTGTTAAGCAGTCTGTATGATGCGTTTGTATTG
Associated Phenotype:
Not determined