Busch Lab

ZMP

celf2

Ensembl ID:
ENSDARG00000002131
ZFIN ID:
ZDB-GENE-030826-35
Description:
CUGBP Elav-like family member 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0B1]
Human Orthologue:
CELF2
Human Description:
CUGBP, Elav-like family member 2 [Source:HGNC Symbol;Acc:2550]
Mouse Orthologue:
Celf2
Mouse Description:
CUGBP, Elav-like family member 2 Gene [Source:MGI Symbol;Acc:MGI:1338822]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa38441 Nonsense Mutation detected in F1 DNA Not yet available
sa11849 Essential Splice Site Available for shipment Available now
sa30851 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33469 Nonsense Available for shipment Available now
sa20284 Nonsense Available for shipment Available now
sa20283 Essential Splice Site Available for shipment Available now
sa26299 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2160 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa38441
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 None None 514 None 13
ENSDART00000077926 None None 493 None 13
ENSDART00000128368 None None 505 None 14
ENSDART00000129320 Nonsense 60 585 1 15
ENSDART00000132615 None None 493 None 12
ENSDART00000133433 None None 468 None 12
ENSDART00000135942 None None 448 None 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 None None 448 None 12
Genomic Location (Zv9):
Chromosome 4 (position 23053913)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24395975
GRCz11 4 24116950
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACTCACTCAATCAGCCGCATTTCTGTCCGAGCAAAGCCCGAGCTGCC[C/T]GAGCCTCAAACATGGTCTCTATAATCTCAGACCTGGACCCCCTCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11849
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 None None 514 None 13
ENSDART00000077926 None None 493 None 13
ENSDART00000128368 None None 505 None 14
ENSDART00000129320 Essential Splice Site 93 585 2 15
ENSDART00000132615 None None 493 None 12
ENSDART00000133433 None None 468 None 12
ENSDART00000135942 None None 448 None 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 None None 448 None 12
Genomic Location (Zv9):
Chromosome 4 (position 22996017)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24338079
GRCz11 4 24059054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCTCTCACAGGCAGGACGCAAGTGATCTGACTGGAACTATACAGAGG[T/A]AAGACTGTCTCCATCTCTCGCTCTGTCAATTATTTGYACACACTTCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Essential Splice Site 22 514 1 13
ENSDART00000077926 None None 493 None 13
ENSDART00000128368 None None 505 None 14
ENSDART00000129320 None None 585 None 15
ENSDART00000132615 None None 493 None 12
ENSDART00000133433 None None 468 None 12
ENSDART00000135942 None None 448 None 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 None None 448 None 12
Genomic Location (Zv9):
Chromosome 4 (position 22968654)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24310716
GRCz11 4 24031691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCGAACAGCGCTGTCTCCATGAGGAGCACAGAGGAACTACTGCTGAG[G/A]TAAAGCTGTCCCTGGACAGCACACAAAGACATGCATGCTTACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Nonsense 28 514 2 13
ENSDART00000077926 Nonsense 32 493 2 13
ENSDART00000128368 Nonsense 19 505 2 14
ENSDART00000129320 Nonsense 99 585 3 15
ENSDART00000132615 Nonsense 7 493 1 12
ENSDART00000133433 Nonsense 7 468 1 12
ENSDART00000135942 Nonsense 7 448 1 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Nonsense 7 448 1 12
Genomic Location (Zv9):
Chromosome 4 (position 22899512)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17566280
GRCz10 4 24242847
GRCz11 3 17716020
GRCz11 4 23963822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAACGCTCATTTATTTCTTCTGTCTTTGCAGTAACGGTACAGCTGGG[A/T]AGATGAACGGCGCTCTGGAGCATTCAGACCAGCCTGATCCGGACGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20284
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Nonsense 87 514 2 13
ENSDART00000077926 Nonsense 91 493 2 13
ENSDART00000128368 Nonsense 78 505 2 14
ENSDART00000129320 Nonsense 158 585 3 15
ENSDART00000132615 Nonsense 66 493 1 12
ENSDART00000133433 Nonsense 66 468 1 12
ENSDART00000135942 Nonsense 66 448 1 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Nonsense 66 448 1 12
Genomic Location (Zv9):
Chromosome 4 (position 22899335)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24242670
GRCz11 4 23963645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACCAGATCAACATACTGCGAGACCGCAGCCAGAACCCACCACAGAGC[A/T]AAGGTAGAGCACGTTTCTTGTCTTTATGCATCACACATGTAGACCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20283
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Essential Splice Site 131 514 4 13
ENSDART00000077926 Essential Splice Site 135 493 4 13
ENSDART00000128368 Essential Splice Site 122 505 4 14
ENSDART00000129320 Essential Splice Site 202 585 5 15
ENSDART00000132615 Essential Splice Site 110 493 3 12
ENSDART00000133433 Essential Splice Site 110 468 3 12
ENSDART00000135942 Essential Splice Site 110 448 3 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Essential Splice Site 110 448 3 12
Genomic Location (Zv9):
Chromosome 4 (position 22874281)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24217616
GRCz11 4 23938591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCACCATCCCATACAGATGAAGCCCGCAGACAGTGAGAAATCAAATG[G/A]TGAGTGTCTCCTATATTTTGTCTCCAGTACGCTTGTCTTTCCATCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26299
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Essential Splice Site 176 514 5 13
ENSDART00000077926 Essential Splice Site 180 493 5 13
ENSDART00000128368 Essential Splice Site 167 505 5 14
ENSDART00000129320 Essential Splice Site 247 585 6 15
ENSDART00000132615 Essential Splice Site 155 493 4 12
ENSDART00000133433 Essential Splice Site 155 468 4 12
ENSDART00000135942 Essential Splice Site 155 448 4 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Essential Splice Site 155 448 4 12
Genomic Location (Zv9):
Chromosome 4 (position 22868036)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24211371
GRCz11 4 23932346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGATCGAGGAGTGCCGCATCTTACGGGGACCAGACGGACTCAGCCGAG[G/A]TGAGACACATGCATATTATACAACAATCATATTGAAAAAGAAACATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2160
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Nonsense 398 514 11 13
ENSDART00000077926 Nonsense 377 493 10 13
ENSDART00000128368 Nonsense 389 505 11 14
ENSDART00000129320 Nonsense 469 585 12 15
ENSDART00000132615 Nonsense 377 493 10 12
ENSDART00000133433 Nonsense 352 468 9 12
ENSDART00000135942 Nonsense 332 448 9 12
ENSDART00000138873 Nonsense 92 208 3 5
ENSDART00000139439 Nonsense 332 448 9 12
Genomic Location (Zv9):
Chromosome 4 (position 22828693)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24172028
GRCz11 4 23893003
KASP Assay ID:
554-2888.1 (used for ordering genotyping assays)
KASP Sequence:
GKTCGGCCGGGCCTATGGACGCTCTCACACAGGCCTACTCAGGGATCCAA[C/T]AGTAYGCGGCTGCCGCCCTGCCCACCCTCTMCAGCCAGTCCCTACTGCAG
Associated Phenotype:
Not determined