Busch Lab

ZMP

slc5a2

Ensembl ID:
ENSDARG00000002129
ZFIN ID:
ZDB-GENE-040426-2498
Description:
sodium/glucose cotransporter 2 [Source:RefSeq peptide;Acc:NP_998091]
Human Orthologue:
SLC5A2
Human Description:
solute carrier family 5 (sodium/glucose cotransporter), member 2 [Source:HGNC Symbol;Acc:11037]
Mouse Orthologue:
Slc5a2
Mouse Description:
solute carrier family 5 (sodium/glucose cotransporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:218

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35819 Nonsense Mutation detected in F1 DNA Not yet available
sa14174 Nonsense Available for shipment Available now
sa42503 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35819
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040380 Nonsense 77 662 3 15
Genomic Location (Zv9):
Chromosome 15 (position 13572743)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14688968
GRCz11 15 14624925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTCTTTTTGCGAGCAACATTGGCAGTGGACATTTTGTTGGTCTTGCT[G/T]GAACAGCAGCTGCGAGTGGAATTGCTGTCGGGGGGTTTGAGTGGAATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14174
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040380 Nonsense 102 662 4 15
Genomic Location (Zv9):
Chromosome 15 (position 13574046)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14687665
GRCz11 15 14623622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TMATTGTTCTTTGTTTCACAGGCAYTATTTATTGTTTTGTTGTTGRGCTG[G/A]GTGTTTGTACCAGTTTATTTAACTGCAGGGGTAGGTTCATTTTATGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42503
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040380 Essential Splice Site 286 662 8 15
Genomic Location (Zv9):
Chromosome 15 (position 13583753)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14677958
GRCz11 15 14613915
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTTTGGCATTGCAATTATTGGTAGCTGGTACTGGTGTACTGATCAG[G/A]TAACGACAGGGTATTTCAGAATTATACATAATGTTGTCTACTTCTTTGTT
Associated Phenotype:
Not determined