Busch Lab

ZMP

hm:zehs0001

Ensembl ID:
ENSDARG00000002084
ZFIN IDs:
ZDB-GENE-030131-169, ZDB-GENE-030131-169, ZDB-GENE-081030-4
Description:
Novel protein similar to vertebrate laminin, beta 2 (Laminin S) (LAMB2) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
LAMB2
Human Description:
laminin, beta 2 (laminin S) [Source:HGNC Symbol;Acc:6487]
Mouse Orthologue:
Lamb2
Mouse Description:
laminin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99916]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10763 Essential Splice Site Available for shipment Available now
sa43957 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10763
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Essential Splice Site 330 1782 9 33
ENSDART00000147326 Essential Splice Site 330 1782 10 34
Genomic Location (Zv9):
Chromosome 23 (position 20502053)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20287160
GRCz11 23 20213503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGTGGCATAAATCTCTGATRTCATRGCTAATATATTTCTGTTTTTCCC[A/C]GAATGCAACTGTAATGGTCACTCCAACCAGTGTCATTTTGACATGGCGGT
Long Flanking Sequence:
AGCTGAAGATCACAAATCTTCGCCTGAATCTTACCAAGCTGCACACTCTGGGTGACAATCTGCTGGACTCACGGCCTGAGATCAAGGAGAAATACTACTATGCCATGTATGAGCTGGTCGTCAGGGGCAACTGCTTCTGCTATGGCCACGCCTCTGAGTGTGCGCCAATTGAGGGCATCAGGGATGACATTGAAGGCATGGTAAGTTAAGGAGTTGCTGGATAATTTTTTGTACCAAAATAGAGAAGTTGGTTAATATTACAAGAAACGCTGACGTTCAGCATTTTCATTCTTAGGTTCACGGGAGGTGTGTGTGCAAACACAACACTAAAGGACTGAACTGTGAACAGTGTGACGACTTCTACAATGATCTGCCCTGGAGACCAGCAGAAGGCCGGAACACTAATGCCTGCAAGAGTAATTATAGATTCTAATATAGATCACACCATACATAGTGGCATAAATCTCTGATATCATAGCTAATATATTTCTGTTTTTCCC[A/C]GAATGCAACTGTAATGGTCACTCCAACCAGTGTCATTTTGACATGGCGGTGTATTTGGCAACGGGGAACATCAGTGGAGGTGTGTGTGACAACTGCCTTCACAACACCATGGGCAGCAACTGTGAGAGCTGTAAACCTTTCTACTACCAGGATCCAACTAGAGATATTAGAGACCCTGGAGTCTGTGTAGGTAAGTGTGACTACTCACTTACTATCTTTCGGCTTAATCCCTGATTTATCGAGATATTTCCAGCTGCAGACCTACACACACACAATCTAGCACACACGTTCTAGGCAACCTCCTATTTGGTTAATGACAGATCAGTCTTGTTCTAATTTGTCTTGTATAACGACGACTAACTGCTTGGGAGCATTATCGCCACCTACTGAATTACACAAGTATGGCGATCAAGACCGCCCGTGCTATGATTGCCATTCATTAGACTGTGAACAGACTCCCATTTTAGGTATTATTTCATTATTACAGTATATCGCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 394 1782 10 33
ENSDART00000147326 Nonsense 394 1782 11 34
Genomic Location (Zv9):
Chromosome 23 (position 20500759)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20285866
GRCz11 23 20212209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACTGGGGTATAATAAACAATTGGTTTTTGTCTGCCCTTTGTTAGCTTG[C/A]GATTGTGACCCAGATGGCTCTAAGAACGGTGGTGTTTGTGACGGCCATGA
Long Flanking Sequence:
GGGTACAATAAATTAAGTAAAAAATATATTTTTTGCTATTTAAATTTATTTATTGCAATTTCTCCTGGAGTTTCATTGGAGAACTGTGGAAAAAAATTGAAAACACTTCAGTCTATTTTATTTATCGGAAACAATTTTTCCCATTCGCCCATCACAATCACCATATTTGTAAAATAGTATACATTATTGATTATTGTGTACAATATTTATTTACAATATATATAAAATATATTGATGACGATGTCCGAGAAGACGTTAATAACATTAATATGCATTGTGACCATATATGGTTTGCCTAGATTGTGTGTGCTGGATTGTGTGTGCCTGAAACAAGTGTGGGTCTGCGGGTCTGCAGCTGGATATTATTGGATTTATCAGGGGTCACCACAATGGAACAAACCACTAAATACATATGTTTTACACGGCGGTTGCCCTTCCAGCTGCAACCCAGCACTGGGGTATAATAAACAATTGGTTTTTGTCTGCCCTTTGTTAGCTTG[C/A]GATTGTGACCCAGATGGCTCTAAGAACGGTGGTGTTTGTGACGGCCATGATGACCCTTCTCTGGGCATGATTGCTGGACAGTGCCGCTGTAAAGACAATGTTGAAGGTTCACGCTGTGATAAATGCAAGCCTGGTTTCTTTGGCCTGAGTGCTAGTGATCCACGTGGTTGTCAACGTAAGTACAAGCCTTAAAAACTCTTAAATTCACTGAAATAATTGTGTTGTAGGTCTTGAATAATTTTAAACAGGTCTTAATTTTCTTACCCATTTGGGCCGACATGCATCCAATCACAATCCATTTGGCCCAAAAGCCAACAAACATATAAAAAATAGTATAATAAAAATATAGTATAATAGTATAATAAAAATAGTGTATACAACTAGGTTTATTTATTTATTTATTTTTTTTGTGGCAAGCAAAAAAAAAAATCCATTGGCCCAATCGGGCCATTAGAAATAACCATTAGTGTTTAGCCCTGTATAAGTCAAAAATTTAATTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5042
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 1366 1782 26 33
ENSDART00000147326 Nonsense 1366 1782 27 34
Genomic Location (Zv9):
Chromosome 23 (position 20480006)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20265113
GRCz11 23 20191456
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAGAAAACAGAGCGGCTGATTGGCCAAAAGAGAGATGATTTTAACCGC[A/T]AGAACGCTGCTAACAAGCGTACACTCACWGACTTAAATGCAAAAGTTCAG
Long Flanking Sequence:
AAATATTTGAGGTCACTGCTCAACATTTAATAGGCGGCACGGTGGCTTAGTGGTTAGCACTGTTGCCTCACAGCAAGAAGGTCACTGGTTTGAGTCCGTCTAGGTCAGCTGGCATTTTGGTGTGGAGCTTGCATGTTCTCCCTTTGTTCACGTGGGTTTCATCCGGGTGCTCGGTTTTCCCCCACAGTCCAAAGACATGCACTATAGATGAATTGAACAAACTAAATTGGCCATAGTGTCAAAGTGTGTGTGTGAATGAGAGTGTGTAAGGGTGTTTCCCATCGACTATTGAATGAATGGATGAATGAATAATTGTTTAACATTTAATCTTTTTTTCAGGTGCATATGACAGCATCCGGGCCTCGTATAATAAGTCACGTGACGCAGAGCACCGATCAAACAGATCTACCACTGACACTCCCAGCACAGTCAGCCAATCAGCAGACACCCGCAAGAAAACAGAGCGGCTGATTGGCCAAAAGAGAGATGATTTTAACCGC[A/T]AGAACGCTGCTAACAAGCGTACACTCACTGACTTAAATGCAAAAGTTCAGAATCTGGACTTAAAGAAAATCAACGAAAAGGTAAGCAGTGCATTTAGACTGTTTTACAGATATGACATATTGTAAAAGGTTCATTTAAAAAAAAAAATCTATTCTGCCTAGCCTGCTTTACTGAGCTGAAGTTGCTTTTATATTCACATTGGTTCATTTTTGTACAATGGCAACCTGTCATGCGCTCCCTTTATTGTTTACCATGCTAATTAAAATATTCAATCTGAAACAGCATGTAAATATGGCTTACTAATAAGTGTGATTCCTGCATGCCGCCTGCCAACCACTAAGCATACAGTGGTTGCTTTAGGACAATGCGCATGAGAGAATGAGACCATTATGACAAGTTTTGCTTGCTACACAACTGAAAACGAGCTAGATATAATACAGTTTTTGTTCAGAATTGTAGTATTATAATTTATATTATAAAGTACTGTAATTTTTTCTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5041
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 1652 1782 31 33
ENSDART00000147326 Nonsense 1652 1782 32 34
Genomic Location (Zv9):
Chromosome 23 (position 20472277)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20257384
GRCz11 23 20183727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGATCTTAATGATGCAGTGGACAGACTGGGAGACCTGGAGCGCCAGATC[G/T]AGGCATTAAAGACCAAACGTGCCAACAACAGCCTGGATGCTGCACGGGCA
Long Flanking Sequence:
TTCTCCCTGTGTTTGCATGGGTTTCCTCAAGGTGCTCCGTTTTTTCCCATAATCCAAAGACATGTGCTAGAGATGAATTGAATAAGCTAAATTGGCCGTGTGTATGTGTGTGAATGTAAGAGTGCATGGGTGTTTCCCAGTACTGGGTTGCAGATGAAAGGGCATCTGCTGTGTAAAACATATGCTGGATGAGTTGGTGATTAATTTCGCTGTGGCGACCCCTGATTAATAAAAGGACTAAGCCAAAGAAAAATGAATGAATGGTTTGTGGTTAAAACACTCATTTAGCAATTACGAAGTGCAGCAAATTTCAGTACAGCTTCTTTCAACATCTAATAATGTTCCTGCAATAAACCTTACACTCAGTAAAATTCTTGCATTGTCCATATTTGACCATAATGTTTTTTTTGATATCTCTAAAGATCCAGTCAGAGACCTCCGCTAGTGAGAGAGATCTTAATGATGCAGTGGACAGACTGGGAGACCTGGAGCGCCAGATC[G/T]AGGCATTAAAGACCAAACGTGCCAACAACAGCCTGGATGCTGCACGGGCAGAGGAGACGGCCACCATGGCACGGGACAAAGCCAACGAAGCCAAAGAGGTTAGTGGAGCTCATATGTTTGTTTCCAGAGAGTATTTGTGTACTAAAATTTATCGTCTGTTTTAGATCCTGGATGGTGAGCTGTCCGATAAGTACCGTACTGTTCAGGGTCTGATGGACAATAAGGCGAAAACCATGCAGGACGCCAAGCACAAAGCAGAGCAATTGAGAGATGAAGCCAAGGGGCTGCTGAAAGATGCACAGGATAAACTGCAGAGGCTGGCAGGTGAGTGTGTGAGAGTGTCAAGTAAAAACACAGTGGTACAATTCAGTTTGACTGCTTTATTAAATTCGAGATGCATGTTGGATATTAGAGATGGGCAGGGAGTACATAACGTGAAGTTTCCAGACAACAAATGCAAAAAAAATTTTAAGTTACAAAGATGCATGTAATAAAGAATG
Associated Phenotype:
Not determined