Busch Lab

ZMP

si:dkey-120e24.2

Ensembl ID:
ENSDARG00000002020
ZFIN ID:
ZDB-GENE-091113-14
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa18403 Nonsense Available for shipment Available now
sa14901 Nonsense Available for shipment Available now
sa23914 Nonsense Available for shipment Available now
sa3126 Nonsense F2 line generated Not yet available
sa37289 Nonsense Mutation detected in F1 DNA Not yet available
sa1469 Nonsense Available for shipment Available now
sa23915 Essential Splice Site Available for shipment Available now
sa43626 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 55 1724 3 38
ENSDART00000142961 Nonsense 19 1698 1 36
Genomic Location (Zv9):
Chromosome 21 (position 20029273)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21164762
GRCz11 21 21201398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCCTCCGAGAACATGCGAGAGATCCTGCAGAATGTGGCCAAACAACAA[G/T]GAGTCTCCAACATGCGGAAACTCGGCCATCTTAACAACTTTATCAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14901
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 132 1724 5 38
ENSDART00000142961 Nonsense 96 1698 3 36
Genomic Location (Zv9):
Chromosome 21 (position 20036045)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21171534
GRCz11 21 21208170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAGGGACAGTAATATCCTTCAGAAGGTGTTGCGTCTCCAGGTGGATTA[C/A]CTGATTTCCAGGTCTGTWMCACGTTTTATTGCACTAAATKGGGGTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23914
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 482 1724 17 38
ENSDART00000142961 Nonsense 446 1698 15 36
Genomic Location (Zv9):
Chromosome 21 (position 20045872)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21181361
GRCz11 21 21217997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGGTTGTGTTTTGTAGACGGGCGAGTGCTGCGGTTAATTACTTG[A/T]AGAGATTTCATGAGAAGAAGAAGCGAGGCCCCAAACCCAATAGTCTTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4157
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 619 1724 20 38
ENSDART00000142961 Nonsense 583 1698 18 36
Genomic Location (Zv9):
Chromosome 21 (position 20048099)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21183588
GRCz11 21 21220224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCCAGACAGTTAACAGTGGTGGGCTGTCAGTTCATCGAGTTCCTGCTA[G/T]AGTCAGATGAGGTGAGAAGGGAGAACTTGAGGTCANTTTTTTTTTGTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3126
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1021 1724 30 38
ENSDART00000142961 Nonsense 985 1698 28 36
Genomic Location (Zv9):
Chromosome 21 (position 20057922)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21193411
GRCz11 21 21230047
KASP Assay ID:
554-3214.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTTTGGCCTGTGGTCCCCGATGAGGTGGAGCAGCACCAGAACCTACAG[C/T]AGCAGCAGCAACAGCACCAGCAACCCCTCATTCACCTATCRTCAGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37289
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1022 1724 30 38
ENSDART00000142961 Nonsense 986 1698 28 36
Genomic Location (Zv9):
Chromosome 21 (position 20057925)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21193414
GRCz11 21 21230050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGCCTGTGGTCCCCGATGAGGTGGAGCAGCACCAGAACCTACAGCAG[C/T]AGCAGCAACAGCACCAGCAACCCCTCATTCACCTATCGTCAGCTCCCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4947
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Essential Splice Site 1060 1724 30 38
ENSDART00000142961 Essential Splice Site 1024 1698 28 36
Genomic Location (Zv9):
Chromosome 21 (position 20058043)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21193532
GRCz11 21 21230168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGTCCACCAGCTCTAGACACAACAGCGAGAGTGACTCCATTCAGCCAA[G/A]TGAGTGCTGCTCCCAYAGACTCATCCATGACTAACAGCATATAGTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1220 1724 31 38
ENSDART00000142961 Nonsense 1184 1698 29 36
Genomic Location (Zv9):
Chromosome 21 (position 20061106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21196595
GRCz11 21 21233231
KASP Assay ID:
554-1394.1 (used for ordering genotyping assays)
KASP Sequence:
TRAACAGAACTGCAGAACGAAGCTCAGGGGTAGGAGATACCCACCGTGAA[C/T]AAACCAGTCGAGAAAGGCTTGCCGGTGATGGCTCAACCTCTGGAAGCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 None None 1724 None 38
ENSDART00000142961 Essential Splice Site 1462 1698 31 36
Genomic Location (Zv9):
Chromosome 21 (position 20064537)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21200026
GRCz11 21 21236662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGGCTGCAAAGTTCTTCTCGGGCGAGGCAGATGGTAAAGATAAAAATG[G/A]TTACTGAATATTGTATCAGTAGCTCGTTATTCTGCATACAAATCCAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43626
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1587 1724 35 38
ENSDART00000142961 Nonsense 1561 1698 33 36
Genomic Location (Zv9):
Chromosome 21 (position 20066030)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21201519
GRCz11 21 21238155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAATCAGTCCATACACAACCTGGAAGTGATGCCTCAGTCTAAGTA[C/A]TCTGGAGTGTCAGGCTGCAGCGACGCCGTCTCTCAGGGCTCTGGTGGCAG
Associated Phenotype:
Not determined