Busch Lab

ZMP

zgc:56533

Ensembl ID:
ENSDARG00000002002
ZFIN ID:
ZDB-GENE-040426-1067
Description:
hypothetical protein LOC394045 [Source:RefSeq peptide;Acc:NP_957364]
Human Orthologue:
LMCD1
Human Description:
LIM and cysteine-rich domains 1 [Source:HGNC Symbol;Acc:6633]
Mouse Orthologue:
Lmcd1
Mouse Description:
LIM and cysteine-rich domains 1 Gene [Source:MGI Symbol;Acc:MGI:1353635]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39388 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19308 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9066 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39388
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site None 162 2 6
ENSDART00000124991 None None 342 None 5
Genomic Location (Zv9):
Chromosome 22 (position 42143130)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39110635
GRCz11 22 39097219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGGAGCTGCACCTCACCTCACCATAACGCGGAATAAACTCCAGAAGG[T/C]AAGTGATGTGTTAGCATTTTCAACTATTTACATGAACAGATGCTACGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
Genomic Location (Zv9):
Chromosome 22 (position 42146201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39113706
GRCz11 22 39100290
KASP Assay ID:
554-6174.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTGACATGTAAAGGGATCTGCCCTGGATTCCAGCCACATTCCTGGAG[G/A]TAATTTATTCTCTTGACTGAAAATATAAAAATGAGAAGATGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9066
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
ENSDART00000008913 Essential Splice Site 30 162 3 6
ENSDART00000124991 Essential Splice Site 30 342 1 5
Genomic Location (Zv9):
Chromosome 22 (position 42146201)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39113706
GRCz11 22 39100290
KASP Assay ID:
554-6174.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCTGACATGTAAAGGGATCTGCCCTGGATTCCAGCCACATTCCTGGAG[G/A]TAATTTATTCTCTTGACTGAAAATATAAAAATGAGAAGANNNNNNNNNNN
Associated Phenotype:
Not determined