Busch Lab

ZMP

adamts18

Ensembl ID:
ENSDARG00000001999
ZFIN ID:
ZDB-GENE-070815-1
Human Orthologue:
ADAMTS18
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 18 [Source:HGNC Symbol;Acc:17110]
Mouse Orthologue:
Adamts18
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18 Gene

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa14714 Nonsense Available for shipment Available now
sa21040 Nonsense Available for shipment Available now
sa2353 Nonsense F2 line generated Not yet available
sa12213 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14714
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 64 1244 3 23
Genomic Location (Zv9):
Chromosome 7 (position 43059006)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42126511
GRCz11 7 42461876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATGTTGACTCGTGTGATTTAAACTGTGTTTGTTTCACCCACAGATTA[T/A]GATTTTGCCACACCAGTGGAAGTGGACTCCTATGGAGGCTACATTTCGCA
Long Flanking Sequence:
TTGTACTGACTAAGAACAATTTTTAGTTATGTTGAAACATAAGGTCTAGTGCTTTAAAAATATACATTCATTCATTTTCTTTTTGGCCAAGTCCCTTTATTAATTAGTGTTCGCCACAGTGGAATAAACCGCTAACTTACTTAGCATATGTTTTCCGCAGTGGATGCCTTTCCAGCTGCAACCCATCACTGGGAAACACCCATGTTTTTATTAACGCCCTGTTTTTATTATACCGAGTGACAACCTCATTAGGGAGAATTTGATTGGACAAAAATGTGTGTAGTGCAGAATGAGTCATCGATGTATTTGGTGGATGTTTTTCTCAAAAAATAAATAAAGACTACACAAATAAACGAAACCAAAAATCTAACAAACATCAAGAAAAGCTACAAAACTCCTTTAAAGACTCATTACTGTTATATTAGACCACTGCAATTGACCAGTGAAAGACTGATGTTGACTCGTGTGATTTAAACTGTGTTTGTTTCACCCACAGATTA[T/A]GATTTTGCCACACCAGTGGAAGTGGACTCCTATGGAGGCTACATTTCGCATGATGTGTCAAGACATGGACGGAGTCGAAGGTCTCTGTCAGAAGCTGGCAGTTTAGTGCACTATCATGTCTCTGCTTTTGGCAAGGAACTACATTTAGACCTCCAGCCATCCCACGTGCTGGCAGAGGGGTTTACCGTACAGACACTGGGTGCAGAGGGCATCAATACAGCAACACTTGACCCCTCTATTCATAACTGTTTCTATCAAGGTTCCATACGAAACCATTCTGATTCATCTGTGGCTTTATCCACCTGTACAGGTTTGGTAAGTGTCTGCTTTTACACTAAAACATTCACTGAAATCAGATCATTAAAACCTACATACACATTTTCAATATGAATTAAATGCAGTTTGATTGAATGCTGAAGAATATTCTTCAGTGGGTTTCCTCAAGATTTTCAGATGAGGGTTAATTAGGGGTTGAGGTGTTCAGTTAGGGCTGTTATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27012
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 232 1244 4 23
Genomic Location (Zv9):
Chromosome 7 (position 43032381)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42153136
GRCz11 7 42488501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCTGATAAAACTGACCGGACCAGTCGCTTTAAATCTAGCAACCCCTA[T/A]GAAGATCATCACCATCATCACCACCACCACCGTCACCATGATTACCAACA
Long Flanking Sequence:
TTCTGTTTCTAAACAAGCTGTTTCTAATATATCAATTAAAGGTGTTGGTTAGGACAAAAACTCCTTTAAATATGGAAAATAATCCTTCTATTGTGTGCCGTTGCTTTTATTTAGAACACGATTTAAATCAGCCTTTAGGTTCGAAGTTTGGACTTGTTTTGATCCAGGAATGCAATACCTAGTTCAACCACTGGGTGTCAAACTTACATACTGCACCTTTAAATAGTAATCTGTTTATCTGTCTTTCATGCAGACACATTTCAACCAAATTGTTTGTTATTACATTTATACCTCTTCCTCTGTGCTCTGCAGTCGGGCCTGATCCGGTACTCCAGTGAGGAACTTTTCATTACTCCACTACCACAGCATTTGGCTTTACAACACAACTACAGCGCCCCCTCTGGACATCACCCACATGTCATCTACAAGCGGTCAGCTGAGCGCAGAGTGCATGCTGATAAAACTGACCGGACCAGTCGCTTTAAATCTAGCAACCCCTA[T/A]GAAGATCATCACCATCATCACCACCACCACCGTCACCATGATTACCAACACGGAAAGCTTCAGAGACAACATTTCTGCGGACGCCGCAAGCAATGTATGTAAGGGAATTTCCTTTTTAGTTTTTATTTTGTATTTGGAAAGCACATTATATAATTGTAGTAGCATTCATCAGCAAACCTCTTTGAGATATTCTGACTGATTCCAAAAGCAAAACTGTTGAGTCATTATCATCTGTTGTACCGAATGAATTGAATGAAAGCTTGGAAACGGCATGTGAGGTTAATGACTGTGTATTTCCTGCTCTGTCATCGCCTCTCCACTGCTTTTATCTGGGAGCTAGCTTGGAAAGTGGACAAGCAGTTATTTGAGGCAATTTCCAGTTTCTCTCACTCTTTTTCATGAGTTTCCATGCTTTTATCTTTTCACCTGATCCTAACTACAGATACTCCCAAGCCTCCTACAGAGGATCACTTTGTCATGCCTGACGAGTTTGAGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21040
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 295 1244 5 23
Genomic Location (Zv9):
Chromosome 7 (position 43031846)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42153671
GRCz11 7 42489036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTTGAGCAGCAAATCCGAGTAAAACGCTCAGAGATCACATCGAGC[A/T]AAGAGGGTGGGCTGAACGTGGAAACTCTGGTGGTGGCAGACCGGAAGATG
Long Flanking Sequence:
ACCATGATTACCAACACGGAAAGCTTCAGAGACAACATTTCTGCGGACGCCGCAAGCAATGTATGTAAGGGAATTTCCTTTTTAGTTTTTATTTTGTATTTGGAAAGCACATTATATAATTGTAGTAGCATTCATCAGCAAACCTCTTTGAGATATTCTGACTGATTCCAAAAGCAAAACTGTTGAGTCATTATCATCTGTTGTACCGAATGAATTGAATGAAAGCTTGGAAACGGCATGTGAGGTTAATGACTGTGTATTTCCTGCTCTGTCATCGCCTCTCCACTGCTTTTATCTGGGAGCTAGCTTGGAAAGTGGACAAGCAGTTATTTGAGGCAATTTCCAGTTTCTCTCACTCTTTTTCATGAGTTTCCATGCTTTTATCTTTTCACCTGATCCTAACTACAGATACTCCCAAGCCTCCTACAGAGGATCACTTTGTCATGCCTGACGAGTTTGAGCAGCAAATCCGAGTAAAACGCTCAGAGATCACATCGAGC[A/T]AAGAGGGTGGGCTGAACGTGGAAACTCTGGTGGTGGCAGACCGGAAGATGCTGGAGAAACATGGCAGAGACAATGTCACTACCTATGTCCTTACTGTCATGAACATGGTGGGTGGAGCTACTACACTGTACTACATTAAAGACACTTTGTTTCTAAAGTGATGTGTCAAGTAATGTTATGTTAAAAAGGTCTCCAGTCTTTTCAAGGATGGGACTATTGGGAATGATATCAACATTGTTGTGGTCAGCCTCCTCCTACTTGAGAAAGATCCGGTAAGAAAGATAAGTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTTAGCCATAGCTGTTCATCTATCTGTCCATTCATCCATCCACCCACCCATCCATCTATCCATCCATCCATCCATCCATCCATCCATCCATTTTTCGGATGAGACGTTTAACGGAGGTCCTGACTCTCTGGGGTTGTTAAAATCCCAGGATGTTCTTCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8279
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 769 1244 16 23
ENSDART00000004120 Essential Splice Site 769 1244 16 23
Genomic Location (Zv9):
Chromosome 7 (position 43005566)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42179951
GRCz11 7 42515316
KASP Assay ID:
554-6148.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTWTTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGT
Long Flanking Sequence:
AGAAAAGATTGATGCAGCTTCTCTTACTGCAGCAAATTCAGTTTTCACTGTTGATATTTGAAACCAGTTAATCTGGAAGTGACCATTTTGTTGTCTTTGATTTGTTGGATGAAAACGCAGCTTTATTTGCACGTCTTTGATGCGATTATTCTAGTTTTGCTCATAAAGTTCATTTGCATTTTTGGATGGGAACATAGCTAATGTCATGCACAGATATAGGAGGTATGAATACGGGACAAAAATCTGGCTCTTACTGTCATTTTTAAGTGGTCCATGTGCCACTGTAGAGCTCTTCTCTGCAAGCTTTACAGAAAACAACACTTTTTCATCCAAATTCATGTATTTTTTAGAGTACTTACAACCGTCTGGCACCTCATCACTCTTATCCATCTGAAGGAGGTGATAATGCGTCAGTTCAATGATGCCAGTTCTTCTGAAATGGTAGAAGTGGCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTATTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGTGCAGGAGATGGAGATTTCCAACAGCTACCTGGCTGTTCGCAGCCTGAAACGTGGCACTTATTACCTGACGGCGGATTGGACGGTGGACTGGCCGGGCAGGTTCCAGTTTGCCGGTACTACATTCAACTATCAGCGCTCTTTCAACCGGCCTGAGACGTTGTTCGCCACAGGCCCCACTAATGAGACCCTGCTCTTTGAAGTGAGTCACCCCCGTTCCCGTTCTGCCTGACACCTGTTAGCGAATTAGCCATGACAGGGTCTTGGCAAGAGCGCCGTGGCCATTCGGTCAGATGAAAACAAGGCTAAGGGACAGTGGGTGGGCGAGAGAGATGAGAAGCAAATGAGGGAAAGATAGAGAGAGAGACACAAGAGAAGGCACACAAATGAGCCGAATGGGCAGACTAACGCCTCTGTTTGGGATTAATTGCAGGCCAGAACCGACGTGGTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18885
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 769 1244 16 23
ENSDART00000004120 Essential Splice Site 769 1244 16 23
Genomic Location (Zv9):
Chromosome 7 (position 43005566)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42179951
GRCz11 7 42515316
KASP Assay ID:
554-6148.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTATTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGT
Long Flanking Sequence:
AGAAAAGATTGATGCAGCTTCTCTTACTGCAGCAAATTCAGTTTTCACTGTTGATATTTGAAACCAGTTAATCTGGAAGTGACCATTTTGTTGTCTTTGATTTGTTGGATGAAAACGCAGCTTTATTTGCACGTCTTTGATGCGATTATTCTAGTTTTGCTCATAAAGTTCATTTGCATTTTTGGATGGGAACATAGCTAATGTCATGCACAGATATAGGAGGTATGAATACGGGACAAAAATCTGGCTCTTACTGTCATTTTTAAGTGGTCCATGTGCCACTGTAGAGCTCTTCTCTGCAAGCTTTACAGAAAACAACACTTTTTCATCCAAATTCATGTATTTTTTAGAGTACTTACAACCGTCTGGCACCTCATCACTCTTATCCATCTGAAGGAGGTGATAATGCGTCAGTTCAATGATGCCAGTTCTTCTGAAATGGTAGAAGTGGCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTATTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGTGCAGGAGATGGAGATTTCCAACAGCTACCTGGCTGTTCGCAGCCTGAAACGTGGCACTTATTACCTGACGGCGGATTGGACGGTGGACTGGCCGGGCAGGTTCCAGTTTGCCGGTACTACATTCAACTATCAGCGCTCTTTCAACCGGCCTGAGACGTTGTTCGCCACAGGCCCCACTAATGAGACCCTGCTCTTTGAAGTGAGTCACCCCCGTTCCCGTTCTGCCTGACACCTGTTAGCGAATTAGCCATGACAGGGTCTTGGCAAGAGCGCCGTGGCCATTCGGTCAGATGAAAACAAGGCTAAGGGACAGTGGGTGGGCGAGAGAGATGAGAAGCAAATGAGGGAAAGATAGAGAGAGAGACACAAGAGAAGGCACACAAATGAGCCGAATGGGCAGACTAACGCCTCTGTTTGGGATTAATTGCAGGCCAGAACCGACGTGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2353
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 975 1244 19 23
Genomic Location (Zv9):
Chromosome 7 (position 42985459)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42200058
GRCz11 7 42535423
KASP Assay ID:
554-2668.1 (used for ordering genotyping assays)
KASP Sequence:
CTGAGGAAGGTGACGTACCAGCGGGAGGAGGTGGCSGCTCAGTCCTTGTG[C/A]CCAGTAATGGCTCCGGCTCAACTACAGCCCTGCAACACACAGTCATGTCC
Long Flanking Sequence:
CAATCAGCAATCAGTAAGGCTCAATTGATCATGTGACATAAAAGACAGGGGGGGAAAAAATCAAATACAAACCAGTTATTTTAAGTCATAAATGATGTTGATGCAGTATGGATGTCCAGTGTCCTCCTCCATGTTAAAATGTGATAAAATAATAAAAACACAAGCTTTGTGTCTAAAGGTTTTTATATTTTTGATCACCAATCAGCAAGACTCAGTGGACCATGTGACATAAAAAAATAATGGTGTTGTCTTTATATATTTATTGTTGTAAATAACTGTGTTTAATAGTAGACTATAGTAAAGTACTATGCTCACTTCTGAGGTAATGTGAAATAGCTCGGGTTCATGCCTCAAGATCAGATGTTTTGTCTTGACAGCTGGACCACAGGTAAATGGGGAGTGTGTAGCAGAACATGTGGAGGTGGCCAGCAGACGAGAAACATCCGCTGCCTGAGGAAGGTGACGTACCAGCGGGAGGAGGTGGCCGCTCAGTCCTTGTG[C/A]CCAGTAATGGCTCCGGCTCAACTACAGCCCTGCAACACACAGTCATGTCCTCCAGAGTGGAGTACCAGCTCCTGGACCCAGGTACTGTTGGATTACACACAATATTCTGTCAATTCTTTGCACTTTATGTTTTTTTTCAGCATTTTAGTTTTTGTGGTTTGAAAAGAGTGGATTCACAATGTCACTTGTACAGTCTGACTAGTGTGTAATTGTATTGTGTTAAGTTTTAAGATGTTTTGTAGAGTATACTGTATATGCAGTCAGGTATATATGTTTAGGATAAATAGGATAGGTTATTTTGTTTTGCTTAAGTTTCAATGATGACCAAATATATTACAAAACCTACAGAGAAACAAAACAAGAAAAAAAGTATATCTTATTACTTTATTTTAGGGTACAATTCTTGCTATTGCCAAACCATTACCTATGACATTTCACTCAACAAACTAATTTGCTTATTAAGGTAATGAGATCATACAGAATATGTACTTTACACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12213
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 1146 1244 21 23
Genomic Location (Zv9):
Chromosome 7 (position 42981082)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 42204435
GRCz11 7 42539800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCGGACCTTCTGTGACACTGGGCTGGTACTCTTCTCCTTGGCTGCAGG[T/C]TTGTGTAACTAGCTCTTCATAACTAATCAGTCCTTTGTTSTGTCTCTATT
Long Flanking Sequence:
TAATACAAAAGTTATAAAAAAAAAAAAAACTAAGTAAGTTTTAAGTGACTCATGATTGTAATATATTACTTCTAAAAGTAACTTAACCCAACCCTGCCCATTAGGAAGTGTTATGGCCAATTAAACACTGCGTGTGCGTGGATATTAATGATCCTTTGTGGATCGTCAGAGTCTTTGTCGATTTTCTCATTGGCATTTTGTTTTACCCTCATAGGATTTGCATGGAAACAATGTGTTATCTAATTGTTGGGTTATTTGACAGTGTTCGGCCTCCTGTGGAGCAGGAGTAAGGAGAAGAGAGCTGCACTGTGGGGAGAAAGACTCTCAAGGAGGCTACACCGAGTTCCCTGCGAGGAGGTGCAGGAACTTACAAAAGCCTGAAGCAGATCTCGAGCAATCCTGTAATAACGGCCCTTGCCCAGAGCCCTTGGCACCCCAGCTCCTCCAGCCTGGCGGACCTTCTGTGACACTGGGCTGGTACTCTTCTCCTTGGCTGCAGG[T/C]TTGTGTAACTAGCTCTTCATAACTAATCAGTCCTTTGTTCTGTCTCTATTCTGCCAAGGCTCTAATATTTCGGTCCTGTCTCTGTGTATTTCAGTGCACAGTGTCCTGTGGTGGTGGGGTGCAGACACGCAGTGTTCAGTGTCTGAGACAGGGGCGTCCGTCAGTGGGCTGTTTCCCTCACCAGAGACCGATAAGCTCACGGGCCTGCAATACACACTTCTGTCCTGCTCCAATCCCAGTGCCAGTCCCACCTCCTTCACCCACTCTTAAAGGTAAAAGCTGCTTTAGTTTAACATTTGACATTCGAATCAAACAAAACATCATTTTCAGTCTGTACTGCTATTTAAACACTTTTGGTCAGTAAAATTATAAAATAAAAAGTGCTATAAAGCAAGTATAACTAAATACTGTTTTAAACTTTCTACTAACTCTTTTTCCCACCATTGACTAGAAATCTTGTCTCAAATTATAAGATAATCAGAGAACATTAAAGTCAGATT
Associated Phenotype:
Not determined