Busch Lab

ZMP

prkag2

Ensembl ID:
ENSDARG00000001933
ZFIN ID:
ZDB-GENE-070912-442
Description:
Novel protein similar to protein kinase, AMP-activated, gamma 1 non-catalytic subunit (Prkag1) [Sour
Human Orthologue:
PRKAG2
Human Description:
protein kinase, AMP-activated, gamma 2 non-catalytic subunit [Source:HGNC Symbol;Acc:9386]
Mouse Orthologue:
Prkag2
Mouse Description:
protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1336153

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44523 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44523
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009945 Nonsense 145 533 4 16
ENSDART00000142649 None None 330 None 11
ENSDART00000143375 Nonsense 145 185 4 4
Genomic Location (Zv9):
Chromosome 2 (position 12906075)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13431300
GRCz11 2 13114086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCATTGTCACAGGTTCTGGGCTTTCAAGTCCTCCCACCACCCCAACA[C/T]AGAGTCCAGTTCCACCGGTCTTTGCTATGGAGACATGCAGTCATGTTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3411
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009945 Essential Splice Site 258 533 7 16
ENSDART00000142649 Essential Splice Site 53 330 3 11
ENSDART00000143375 None None 185 None 4
Genomic Location (Zv9):
Chromosome 2 (position 12919556)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 13444781
GRCz11 2 13127567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTAAMAAGAAAAGCTTTATGATTATGATATAWTTCTTTTGTTCTCTGTT[A/G]GGTAAAGAAAGCCTTTTTTGCCTTGGTTGCCAATGGAGTTCGAGCTGCCC
Associated Phenotype:
Not determined