Busch Lab

ZMP

LOC555361

Ensembl ID:
ENSDARG00000001909
Human Orthologue:
VILL
Human Description:
villin-like [Source:HGNC Symbol;Acc:30906]
Mouse Orthologue:
Vill
Mouse Description:
villin-like Gene [Source:MGI Symbol;Acc:MGI:1201781]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa32486 Nonsense Available for shipment Available now
sa14098 Nonsense Available for shipment Available now
sa12859 Nonsense Available for shipment Available now
sa9242 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24481 Nonsense Available for shipment Available now
sa39445 Nonsense Mutation detected in F1 DNA Not yet available
sa14066 Nonsense Available for shipment Available now
sa8412 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa575
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 23 850 1 19
Genomic Location (Zv9):
Chromosome 24 (position 21049338)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20296467
GRCz11 24 20440886
KASP Assay ID:
554-0485.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTAAGAACATCCAGCGAAAGCCTGGCCTGCAGATCTGGACCATCAAT[G/A]TAAGACATCACTGTTGCTGCTTATTTCCATGCTCTTTTATTTGTCAGATT
Long Flanking Sequence:
ATCATTTACTAGTGACTCACACGTACTGGGTGAATTGAATTAGTGGCTTGTTAGCTAGAGAGAGACTCGTTCTGAAATAGATCATTTAAATCAGTGAATCGTTACATGAGTAGACTATAGTGAAAACACAAAAGTAGATATTTTAAAGGATCTGAATAGTTTATGGTCACTATTGACTTCCCAACATTGAGAAGAAAAAATGGTGGACTTTCACTAGTGGAAGGATGAAATTTACTTTCAAAATGTTTCATAATAAATGACACTTTTGGCTGGCATGTATTTAAATATTATATAAATATACATATTACATAAATGTAAGAATATTGTGTAATATACCTATTGTTATTATCGGTCATGAAGAATAATTTTTTGGTTATGTGTTTTGAATCAGATAATTCAAGCATTGAGATTTCTTCTCAGAGTTCAGCAGAATGACTGAAGCCCACGATTTGTTTAAGAACATCCAGCGAAAGCCTGGCCTGCAGATCTGGACCATCAAT[G/A]TAAGACATCACTGTTGCTGCTTATTTCCATGCTCTTTTATTTGTCAGATTTCATTAAGCTTTGAAACAAAACACAAGAAAACAAGTTATCCCTAGCATTATGTATTATTCTGTTTTTAGAAAATGCAGATGGTCGCTGTTCCAGAGCAAGCATTTGGGAATTTTTTTGAGGGCGATTGCTACATCATACTTAATGTAAGTCATCTGCAATTCAGTTTAATTCACAACTTATTTTTAAAAGTGCTTTTGGAAAAGACGATGCTTTTGAACATCTTCATTTAGCAATATTTTATGAAGTTTATTTATAAACTAATTTTGAGAAGATCACATGCTTATGATTGACCACGGCTGGTCCTGCATTACCTAACACGTGATGTACCAATCAAATGATTCCTAACTCACTACAAAAAAACTGTGTTTCTTACCTTAGTTATCCTCGTCTTGAAGAATCCCCCCTTCCACCCCTACTCCTCCATATTTTCCTTGATCAGGCAGCACGCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32486
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 173 850 5 19
Genomic Location (Zv9):
Chromosome 24 (position 21045120)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20292249
GRCz11 24 20436668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTAATCTAGGGGACGTTTTCCTGCTAGACTTGGGAAAAGCTATAATA[C/T]AATGGAATGGTCCTCAAAGCAACAGACAAGAGAAGTTAAAGGTAATTATA
Long Flanking Sequence:
TTGCAAATGTAAAATAATCTTTTAACATGTTTATTGTAGAAAAATGACAGGCTAATTTATTTCACCCTTGTTTTAAATGACAAAACAATAATTTATGCCTAACTTGATTTATAAAGGGTGTCATAGCTCATTATCCTGGTCGCAGTTTAGTTCACTTTGTGAGTACAGATATTTCTATTGCGGGCAAATGCTCAGATTTAAAAGGATCAGTAGATGAAGCTGTCAGACTGTAAATTATTGAATCAAAAGGTCAAGAATCTTTTTTTTGGATCACTGCGGACTATCCTTGTTTCTTCTGACATATCTCTCTTACTCCAGTCTTTTCCCTTGCACATTTTAGAAAGAAACACATTGTTAAATATATTATATATGCCACAAATTATTAAGGACACAACAGGATTATTTCAGGAGTTTCTGATTTCTTTCTGCAGGTGGAGGTGTCCTGGAACAGTTTTAATCTAGGGGACGTTTTCCTGCTAGACTTGGGAAAAGCTATAATA[C/T]AATGGAATGGTCCTCAAAGCAACAGACAAGAGAAGTTAAAGGTAATTATAGAAATCGTTAACTTAAATACGAAACTTCTGTCATTAATTACTCAATCTTATAATGTTCCAAACCGTGAGACCTGTGAGGCACAAAGAGTTCTTTGACCCTCCATAGACTGCAGGGTTCTGAAAGCTCAGAAATGTACCAACAATACCAGTCCATGTGCCATCAGTGATTCAATCTTAATTTGATGAAGTCATAAAAATACTTTGTGTAATCAAAATATCAACTTTTTTACCAGTTTTTTTCTCATCATCATCAATTCAAGTAAAATGTTTAAGAGAGCATTGTGTACTGTATCAAAGTCCCTTTAAGGCAGGTCATTTTTTTCGGCAGCCATCTTTAAAATGCCTCTTACTCGGGCATTCTGTCTGAATGGGGAAACATCAAATTCTCCAAAACTTTTTGACAAGTTTACTATTACATTACTTATTTGGAACCACCAATAAAATGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14098
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 182 850 5 19
Genomic Location (Zv9):
Chromosome 24 (position 21045093)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20292222
GRCz11 24 20436641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TRGACTTGGGAAAWGCTATAAYACAATGGAATGGTCCTCAAAGCAACAGA[C/T]AAGAGAAGTTAAAGGTAATTAWAGAAATCGTYAACYTAAATAYGAAACTT
Long Flanking Sequence:
TGTTTATTGTAGAAAAATGACAGGCTAATTTATTTCACCCTTGTTTTAAATGACAAAACAATAATTTATGCCTAACTTGATTTATAAAGGGTGTCATAGCTCATTATCCTGGTCGCAGTTTAGTTCACTTTGTGAGTACAGATATTTCTATTGCGGGCAAATGCTCAGATTTAAAAGGATCAGTAGATGAAGCTGTCAGACTGTAAATTATTGAATCAAAAGGTCAAGAATCTTTTTTTTGGATCACTGCGGACTATCCTTGTTTCTTCTGACATATCTCTCTTACTCCAGTCTTTTCCCTTGCACATTTTAGAAAGAAACACATTGTTAAATATATTATATATGCCACAAATTATTAAGGACACAACAGGATTATTTCAGGAGTTTCTGATTTCTTTCTGCAGGTGGAGGTGTCCTGGAACAGTTTTAATCTAGGGGACGTTTTCCTGCTAGACTTGGGAAAAGCTATAATACAATGGAATGGTCCTCAAAGCAACAGA[C/T]AAGAGAAGTTAAAGGTAATTATAGAAATCGTTAACTTAAATACGAAACTTCTGTCATTAATTACTCAATCTTATAATGTTCCAAACCGTGAGACCTGTGAGGCACAAAGAGTTCTTTGACCCTCCATAGACTGCAGGGTTCTGAAAGCTCAGAAATGTACCAACAATACCAGTCCATGTGCCATCAGTGATTCAATCTTAATTTGATGAAGTCATAAAAATACTTTGTGTAATCAAAATATCAACTTTTTTACCAGTTTTTTTCTCATCATCATCAATTCAAGTAAAATGTTTAAGAGAGCATTGTGTACTGTATCAAAGTCCCTTTAAGGCAGGTCATTTTTTTCGGCAGCCATCTTTAAAATGCCTCTTACTCGGGCATTCTGTCTGAATGGGGAAACATCAAATTCTCCAAAACTTTTTGACAAGTTTACTATTACATTACTTATTTGGAACCACCAATAAAATGAATCAATAACTGTCTTGTAAGTTTTATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 266 850 7 19
Genomic Location (Zv9):
Chromosome 24 (position 21041124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20288253
GRCz11 24 20432672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WGCTTGGGTTTTTTCACAGGGTGTCAGAYGCCAGTGGTCAGCTGYTGGTA[C/T]AGGAAGTGGCTGTCAGTCCACTCACCCAGGATCTGCTGTGCTCCTCTGTG
Long Flanking Sequence:
GAGGCTGGACAGTGTCAGTTGGTTGATGAGCTGAGGTTGAATTGAGGTTACCGAAAGATGAGGCAGAAACAGAGAATCAGTACACTATGACAAAGCTAGAGAATGGAAGCCCCATGGCAGAGCCAATAGAAGAGCCAACAAGAGTGAAAAAACTGGGTATGAACCTAAAACACAGAGCATGTGCTGCATGAGGAAACAAACAACTCAAGAACAGGTGAAGAACAAATGAAGAACAGGTAGTGCTGGATGGGACCAGAAGCAATGAATCTCTTCCATTTCACTTGCTATTTCCATTTCCTAGTCAATCAAACAGGGCTCTTCTCATCCAGCTCAATGATTGATTGTGTAAATAGCTAGCATTGAAGCATTAGCAACATCCTTGTTGTTGATAACAACTGCTGATAATTACTTGATAATTTAGTGCTAACATTAAACAAAATAACTTTAATTTGCTTGGGTTTTTTCACAGGGTGTCAGACGCCAGTGGTCAGCTGTTGGTA[C/T]AGGAAGTGGCTGTCAGTCCACTCACCCAGGATCTGCTGTGCTCCTCTGTGAGACATCAAAATTCAAATCTCAATACCTAATGCTTCACATTACCATTATATAATTACACAACTGAAAGTGGATGAATGGTTTGATGTATGTCTTGTTTGCAGGATTGCTATATTTTAGATCAAGGTGGCACCTCGATAATGGTCTGGAAGGGAAAAGGAGCTTCAAATGAAGAGAGGCGCTCGGCGATGGGCCGGGCAGTTGTAAGTACAAAAGTTTGTGAATTATTATTATTCTCCAAAATGGCCAAAATCTTTCACAATTGGTGCACAAATGTTCATCGACACAGGGATTTATAAAAGCAAAGAACTACCCGGCCAGCACTAAAGTGGAGGTCATGAGTGAAGGAGGAGAATCTGCTATGTTTAAACAGCTCTTCAAGTCTTGGACTGAAAAAGGTCAAACTCAAGGCCTGGGAAAGACACACTCAGTAGGAAAGATAGGTGATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9242
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 365 850 9 19
Genomic Location (Zv9):
Chromosome 24 (position 21040632)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20287761
GRCz11 24 20432180
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGGTCAAACYCAAGGCCTGGGAAAGACACACTCAGYAGGAAAGATAG[G/A]TGAYTGGTCATTCAGTGTTATTTCTCATTATGTTTCASTAGTGGGTCAGT
Long Flanking Sequence:
TGTTGGTACAGGAAGTGGCTGTCAGTCCACTCACCCAGGATCTGCTGTGCTCCTCTGTGAGACATCAAAATTCAAATCTCAATACCTAATGCTTCACATTACCATTATATAATTACACAACTGAAAGTGGATGAATGGTTTGATGTATGTCTTGTTTGCAGGATTGCTATATTTTAGATCAAGGTGGCACCTCGATAATGGTCTGGAAGGGAAAAGGAGCTTCAAATGAAGAGAGGCGCTCGGCGATGGGCCGGGCAGTTGTAAGTACAAAAGTTTGTGAATTATTATTATTCTCCAAAATGGCCAAAATCTTTCACAATTGGTGCACAAATGTTCATCGACACAGGGATTTATAAAAGCAAAGAACTACCCGGCCAGCACTAAAGTGGAGGTCATGAGTGAAGGAGGAGAATCTGCTATGTTTAAACAGCTCTTCAAGTCTTGGACTGAAAAAGGTCAAACTCAAGGCCTGGGAAAGACACACTCAGTAGGAAAGATAG[G/A]TGATTGGTCATTCAGTGTTATTTCTCATTATGTTTCAGTAGTGGGTCAGTGTGGTGACTGTATATTCATCTGTCATTCAGCTAAAGTGGATCAGGTGAAGTTTGACGTCATGGAGCTTCACGCACAGCCGAAACTGGCTGCTCAGGAGCGGATGGTAGACGATGCCTCAGGACAAGTTCAGGTATGATAAAATATTAATACATTTGGGATTCCTGTCGCACTGATATTGAACATCACCACTGCTTTGTATTCAGGTTTGGCGGATCGAGAATCTTGAACTCAAGGAAGTGGATCGAAGCACTTATGGACAGTTTTATGGAGGAGACTGTTATCTAGTTTTGTACACCTACAACAGAGCCAACAAACCTCAGTATATCCTCTACATCTGGCAGGTGAAGAACAAAACATGCATTGTGCGGAAAGAACATACACATATACTAAACAAATGCCCTTTTCTTATCAATAGGATTATAATTGTATCATGCTACAGCAAATACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24481
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 431 850 11 19
Genomic Location (Zv9):
Chromosome 24 (position 21040282)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20287411
GRCz11 24 20431830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTATGGACAGTTTTATGGAGGAGACTGTTATCTAGTTTTGTACACCTA[C/A]AACAGAGCCAACAAACCTCAGTATATCCTCTACATCTGGCAGGTGAAGAA
Long Flanking Sequence:
TTATAAAAGCAAAGAACTACCCGGCCAGCACTAAAGTGGAGGTCATGAGTGAAGGAGGAGAATCTGCTATGTTTAAACAGCTCTTCAAGTCTTGGACTGAAAAAGGTCAAACTCAAGGCCTGGGAAAGACACACTCAGTAGGAAAGATAGGTGATTGGTCATTCAGTGTTATTTCTCATTATGTTTCAGTAGTGGGTCAGTGTGGTGACTGTATATTCATCTGTCATTCAGCTAAAGTGGATCAGGTGAAGTTTGACGTCATGGAGCTTCACGCACAGCCGAAACTGGCTGCTCAGGAGCGGATGGTAGACGATGCCTCAGGACAAGTTCAGGTATGATAAAATATTAATACATTTGGGATTCCTGTCGCACTGATATTGAACATCACCACTGCTTTGTATTCAGGTTTGGCGGATCGAGAATCTTGAACTCAAGGAAGTGGATCGAAGCACTTATGGACAGTTTTATGGAGGAGACTGTTATCTAGTTTTGTACACCTA[C/A]AACAGAGCCAACAAACCTCAGTATATCCTCTACATCTGGCAGGTGAAGAACAAAACATGCATTGTGCGGAAAGAACATACACATATACTAAACAAATGCCCTTTTCTTATCAATAGGATTATAATTGTATCATGCTACAGCAAATACAGGTGTAAATAGAGTCTACCTCCTATGTCCTGTTTTCCTTTTCTTTTTCATATTTTTTTATCAAAGGGATTGTTTACCCAAAAATAAAAATGTGCTTAAACAACTCTCACTATTTACCTACCTTCAAGGGGTTCTAAACCTATGAATTGATTTATTCTGTTAAAGAAAAATGTTTAAAGAAATCAGGAAACCTGTCACTTTTGGCATATATACAGTAATAAGAAAAACTAATTCTATACAAGTCAATTGTTACAGGTTTTCAGCCTTCTTCAACAGAAGTTGTCCATTTAACTGAAAAAAGAAACTTATAAAGTTTTGAAACGAGTAAAGAGTGAGTAAATAATGACAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39445
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 653 850 15 19
Genomic Location (Zv9):
Chromosome 24 (position 21033569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20280698
GRCz11 24 20425117
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTACTCAGGATGACCTGGATGAGGACGACGTCATGCTGCTCGACACCT[G/A]GGATGAGGTGTGTTTCAGCAGATTAGCACTGTTTGAATGCGGCTGTGGAC
Long Flanking Sequence:
ATAAAGGTTCCACTTAAAATATATTTTTACATGCTGTTTATATTTACAAAAACAATAAAAAATCTACAGAGGAAAAAATATCTATAGAGAAAGAGAATATTTTGAGTTTCGATGTGAGGGCCCCATTCCTGGGATTGCTTAGGGACCCTAAATCCCTAAGCCCCTGACTAGAATCTAGACAAAACTCAAAGTAAGTAAAGCATTATTTACAGTAAATTTACATGCAATAATAAGTAAGTAACAGGTAATAATAAGTAAATAAAACAATCAGTCGTAGGTTAATAAAAATCTGCCGAAATTGTGTTCAGGCAGTTTGTGTGGGCCCACTGATGTCCATGTAAACATATCCATTGTCTCCATTAGACTGGAGGAAGAGGTGTCACTTCATGAGCCCCGTCTGTTCGAGTGCTCCAATCAGACAGGTCGATTCCTCATGACAGAAGTGGCCGACTTTACTCAGGATGACCTGGATGAGGACGACGTCATGCTGCTCGACACCT[G/A]GGATGAGGTGTGTTTCAGCAGATTAGCACTGTTTGAATGCGGCTGTGGACAAATGGTGGTTTCTTTCAGGGTTATGCAGGGTTATTTCAGGGTTTTATGAGGAAACTTGTTTATGAAACAGAAGAAAAAAAGAGAGAAAATTATAGTTTGAGTTAGTTTGACACCAAATTTTGATTTATTCTTACAAATTGTGATATGACTTTTGCTCTCCGAATAGAAGATGTTATCTCAGAGATATAAGAAATATAGCTGTAAATTCAAGATGGATTCTTGACTCGTAATTGAGAGAGGTAAAGATGCGGTCCTGAGAAAAAAAGATGTGAAATGAAAGTCACAATGGCGGGGAAAAACACACGAAATAAAATTATATTTGCTTACTGTATCGTGAGTTGCATCTTAGAGTAATTATTTTCTAAATACCTTGTTTTATTTATTCTGTTTTCATAAAAAATATTTTGGAAAAGTTTTGGCAATTTTTTTTCTTATTTTTTCCTTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14066
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 723 850 17 19
Genomic Location (Zv9):
Chromosome 24 (position 21029826)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20276955
GRCz11 24 20421374
KASP Assay ID:
2261-8648.1 (used for ordering genotyping assays)
KASP Sequence:
ACACTTTYTGAGTTTGACTTTACGTRTATATTCCAGGGAGGCCTTTCATA[T/A]GAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTGDTAAA
Long Flanking Sequence:
TTAAATTTAATATATTTGTATAGTTGTTTTAAATGTTCTATTAAAATCATACTTTTTAAATGAATTTGTTCATATGAATATAGCCATTGTTGCTAACTTAAATCATAAATAACTACATTAATATGCTAAGCATTCATCATTTAAAAGTACAATAGTTTGTGCAGAAAAACTACATTGCCCATGATTCTGTGCAAAATGCCACCAATCAGAGGCATGCAGAAAGCAACGCACAACAACAACAACAGCAACAACAACAAACAACAACAAACAGATCTTAATTTCCTTTCAAACTAAATGCTGAACATTGCTGAAAAAGTAGATGGGCACAATACTGAGCTTTATTCCTACTGGATAAAATCCAGCAGCACAATTCCTCATAATATGAAACTAAATGTGTAATTTCATGTTGAGTTTAAACCATTTGACCATGATTTAATATTTCAAATCAACACACTTTTTGAGTTTGACTTTACGTGTATATTCCAGGGAGGCCTTTCATA[T/A]GAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTGGTAAAATCATTTACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAATAAATGAATCTCACTGGATCAGATTGGTGATCTTATTGTGTTGATATAGACAGATTTAAAAATGATTTAAACCTCATTTTCTCTAGAGTCTCAACAACACAGACTTGAATAAGAAGCCAGGAGGAGGTGTGGGAAACTACAGCGCTCCTGGGGGACCGGGGAGTATACGCTCCCACAATCAGAGGATGTCCAGTGTACAGTTCGGAGATGGGTCTCAAAACAGAGCAAAGCCTTCTGGGATGCAAAATTCAGAGCAGCTTGTTAAAATGCCAAATCAGCTGCCTCAAGGACTGGATCCTGAAAAACGAGAGGTGGGTTTAGGCACCTACAAAACTTTAGGTTTTAGGGTAGTTTTGAACAATTTTGGCTACATTTTGGTCAGACATCACAACACATGGAAGGCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6764
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 738 850 17 19
ENSDART00000048940 Essential Splice Site 738 850 17 19
Genomic Location (Zv9):
Chromosome 24 (position 21029780)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20276909
GRCz11 24 20421328
KASP Assay ID:
554-4961.1 (used for ordering genotyping assays)
KASP Sequence:
CATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/T]TAAAATYATTYACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAAT
Long Flanking Sequence:
TCATACTTTTTAAATGAATTTGTTCATATGAATATAGCCATTGTTGCTAACTTAAATCATAAATAACTACATTAATATGCTAAGCATTCATCATTTAAAAGTACAATAGTTTGTGCAGAAAAACTACATTGCCCATGATTCTGTGCAAAATGCCACCAATCAGAGGCATGCAGAAAGCAACGCACAACAACAACAACAGCAACAACAACAAACAACAACAAACAGATCTTAATTTCCTTTCAAACTAAATGCTGAACATTGCTGAAAAAGTAGATGGGCACAATACTGAGCTTTATTCCTACTGGATAAAATCCAGCAGCACAATTCCTCATAATATGAAACTAAATGTGTAATTTCATGTTGAGTTTAAACCATTTGACCATGATTTAATATTTCAAATCAACACACTTTTTGAGTTTGACTTTACGTGTATATTCCAGGGAGGCCTTTCATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/T]TAAAATCATTTACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAATAAATGAATCTCACTGGATCAGATTGGTGATCTTATTGTGTTGATATAGACAGATTTAAAAATGATTTAAACCTCATTTTCTCTAGAGTCTCAACAACACAGACTTGAATAAGAAGCCAGGAGGAGGTGTGGGAAACTACAGCGCTCCTGGGGGACCGGGGAGTATACGCTCCCACAATCAGAGGATGTCCAGTGTACAGTTCGGAGATGGGTCTCAAAACAGAGCAAAGCCTTCTGGGATGCAAAATTCAGAGCAGCTTGTTAAAATGCCAAATCAGCTGCCTCAAGGACTGGATCCTGAAAAACGAGAGGTGGGTTTAGGCACCTACAAAACTTTAGGTTTTAGGGTAGTTTTGAACAATTTTGGCTACATTTTGGTCAGACATCACAACACATGGAAGGCCATATTCTGCCACTGGATTAAAAAAAGATATGTAAAAGGATGTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8412
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 738 850 17 19
ENSDART00000048940 Essential Splice Site 738 850 17 19
Genomic Location (Zv9):
Chromosome 24 (position 21029780)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20276909
GRCz11 24 20421328
KASP Assay ID:
554-4961.1 (used for ordering genotyping assays)
KASP Sequence:
CATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/A]TAAAATYATTYACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAAT
Long Flanking Sequence:
TCATACTTTTTAAATGAATTTGTTCATATGAATATAGCCATTGTTGCTAACTTAAATCATAAATAACTACATTAATATGCTAAGCATTCATCATTTAAAAGTACAATAGTTTGTGCAGAAAAACTACATTGCCCATGATTCTGTGCAAAATGCCACCAATCAGAGGCATGCAGAAAGCAACGCACAACAACAACAACAGCAACAACAACAAACAACAACAAACAGATCTTAATTTCCTTTCAAACTAAATGCTGAACATTGCTGAAAAAGTAGATGGGCACAATACTGAGCTTTATTCCTACTGGATAAAATCCAGCAGCACAATTCCTCATAATATGAAACTAAATGTGTAATTTCATGTTGAGTTTAAACCATTTGACCATGATTTAATATTTCAAATCAACACACTTTTTGAGTTTGACTTTACGTGTATATTCCAGGGAGGCCTTTCATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/A]TAAAATCATTTACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAATAAATGAATCTCACTGGATCAGATTGGTGATCTTATTGTGTTGATATAGACAGATTTAAAAATGATTTAAACCTCATTTTCTCTAGAGTCTCAACAACACAGACTTGAATAAGAAGCCAGGAGGAGGTGTGGGAAACTACAGCGCTCCTGGGGGACCGGGGAGTATACGCTCCCACAATCAGAGGATGTCCAGTGTACAGTTCGGAGATGGGTCTCAAAACAGAGCAAAGCCTTCTGGGATGCAAAATTCAGAGCAGCTTGTTAAAATGCCAAATCAGCTGCCTCAAGGACTGGATCCTGAAAAACGAGAGGTGGGTTTAGGCACCTACAAAACTTTAGGTTTTAGGGTAGTTTTGAACAATTTTGGCTACATTTTGGTCAGACATCACAACACATGGAAGGCCATATTCTGCCACTGGATTAAAAAAAGATATGTAAAAGGATGTGTAAC
Associated Phenotype:
Not determined