Busch Lab

ZMP

si:dkey-247m21.3

Ensembl ID:
ENSDARG00000001906
ZFIN ID:
ZDB-GENE-091204-249
Human Orthologue:
HTR4
Human Description:
5-hydroxytryptamine (serotonin) receptor 4 [Source:HGNC Symbol;Acc:5299]
Mouse Orthologue:
Htr4
Mouse Description:
5 hydroxytryptamine (serotonin) receptor 4 Gene [Source:MGI Symbol;Acc:MGI:109246]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23906 Nonsense Available for shipment Available now
sa23907 Nonsense Available for shipment Available now
sa12008 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 19 360 2 5
ENSDART00000132853 None None 151 None 4
Genomic Location (Zv9):
Chromosome 21 (position 19065080)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20200569
GRCz11 21 20237205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTGTCAACAGTTCAGTCGATGAAGTTGTGTCTAAACACACTT[C/A]GAGGATAACGCTGTCTATTGTCCTGGTGACCATCATTATAATGACCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23907
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 87 360 3 5
ENSDART00000132853 Nonsense 49 151 2 4
Genomic Location (Zv9):
Chromosome 21 (position 19066925)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20202414
GRCz11 21 20239050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCTGGTTGTGATGCCACTGGCAGCCATAGAGTTAACCACAGGGAAGTG[G/A]AATTATGGAGAGACGTTCTGCCTGGTGCGAACCTCACTGGATGTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025860 Nonsense 207 360 5 5
ENSDART00000132853 None None 151 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19072888)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20208377
GRCz11 21 20245013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCATATGCYCTGGTGTGTTCRGCTGTGGCTTTCTATGTGCCTCTAGTTT[T/A]AAWGGTTCTGGCCTATCAGCGGATCTATGTMACCGCCATGGGACAYGCTC
Associated Phenotype:
Not determined