Busch Lab

ZMP

atp1a1a.4

Ensembl ID:
ENSDARG00000001870
ZFIN ID:
ZDB-GENE-001212-4
Description:
ATPase, Na+/K+ transporting, alpha 1a.4 polypeptide [Source:RefSeq peptide;Acc:NP_571764]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa32576 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32577 Nonsense Mutation detected in F1 DNA Not yet available
sa44502 Nonsense Mutation detected in F1 DNA Not yet available
sa19396 Nonsense Available for shipment Available now
sa19397 Nonsense Available for shipment Available now
sa17542 Nonsense Available for shipment Available now
sa14454 Nonsense Available for shipment Available now
sa13870 Nonsense Available for shipment Available now
sa14079 Nonsense Available for shipment Available now
sa39529 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25505
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 10 1024 2 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1446815)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1542235
GRCz11 1 1690029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTTATCTTAAATATTGTTTTACACATATAGACTGGAAATGATAAGTA[C/A]AAACTGGCGGCAACTTCAGAAGATGAAGCCAAAGCGCCAAAAAAAGGGAA
Long Flanking Sequence:
TAGATACTATAATATATACAGTATCATTCAAAAACACCATGGCATGTACTGTAAATCACTACAGTAAAACCATTAAGCTTATCATCTAGCTGTCAATGACTTGACCTACCTGTGCAGATGAAGGTTGAATAAATGTTAAAGGCTCCATAACAGCAGCCAAACTCCTCCCTGATCCCTGTACAAACTCCTCCCTGAAACAGGTGAGTTGGCAGGGTATAAATTTAGTGAATCTGGCTTGAACACACAGGAGCTTTTTGTCTCCGGAAGGGCTCTCAAGCGGACTACGACATCTGAAAGTCTGAGTTGGAATAATCCAGGAAAATGGGGCTTGGAGTGAGTGGACCGTGGCGGCATTTTTATGATGCTGCTTTGTATATTTTGACTTCCCGTTGTTTCCCTTCTGTTTATCTGATCTCTCACTCTGCTTTGTTGAAGTCAGGTAATGCTTATATGCTTATCTTAAATATTGTTTTACACATATAGACTGGAAATGATAAGTA[C/A]AAACTGGCGGCAACTTCAGAAGATGAAGCCAAAGCGCCAAAAAAAGGGAAAAAGAAGCAAAAGGACATGGATGAGCTTAAGAAAGAAGTGGATCTGGTGCGAAATCAATGCATTTAACATAATTTCCATTATTTAAATCAACAGTGTTGGCTATGTAGTAAGATTCAATGGTGTTTTTCTTTATGCAGGATGACCACAAGTTGACGCTAGACGAGCTTCACCGCAAATACGGGACTGACCTGACCAGGGTGAGTTTAATATCAATTCTGGGGATCATTATGTGTCTAAAATGATTTAAATGCGTGTTTAAATGTCTTAAATAATTATAATATTATTAAATTTTAAAAAGTAGAAGAATAAAAACAGCTGGTACCGTGATTCATAATCACTGAGTGTAGTAATAATAACCTCAATATATCGTTCCAGTCAAATAACAGCAGATTTGGTTAAGAGTTGTTTAAGGCAAAACAGCAGATCCTCATGTATTGGAAACAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32576
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Essential Splice Site 343 1024 9 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1456052)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1551472
GRCz11 1 1699266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATTTGGATATTTGAGCTAAAATAAATACCTAACATGGAACTTTATGT[A/C]GGTGTGTCTGACTCTCACTGCCAAACGAATGGCAAAGAAGAACTGCCTGG
Long Flanking Sequence:
AGACTCGTACTCCTGACTTCTCCAATGATAACCCACTGGAGACCAGGAACATTGCGTTCTTCTCTACCAACTGTGTTGAAGGTGCAAAGACAGTTCACATGTGATAATTAACAGAATTAATGACTTAATTACAAAGTTAAAATATTCAATAGGTACTGCCAGAGGAATTGTCATCAACACTGGTGACCGCACTGTCATGGGTCGCATCGCCACTCTTGCCTCCAGCCTAGAAGGTGGACAGACACCAATTGCTAAAGAGATTGAGCACTTCATCCACATCATCACTGGAGTGGCTGTCTTCTTGGGCGTGTCCTTCTTTATTCTTTCCCTGATTCTTGGATATGGGTGGTTGGAAGCCGTCATCTTCCTGATTGGAATTATTGTCGCCAATGTACCTGAAGGTCTCCTTGCTACTGTAACTGTAAGTGAGAGTACAAACCACACTTGTTGGATATTTGGATATTTGAGCTAAAATAAATACCTAACATGGAACTTTATGT[A/C]GGTGTGTCTGACTCTCACTGCCAAACGAATGGCAAAGAAGAACTGCCTGGTGAAGAATCTTGAAGCTGTGGAGACTCTTGGATCAACCTCTACCATTTGCTCTGACAAGACTGGAACTTTGACCCAGAACCGGATGACCGTCGCTCATATGTGGTTCGACAGCCAGATTCATGAAGCAGACACCACTGAGAACCAGAGTGGAACCACCTTTGACAGGAGCTCTCCTACGTGGTCTGCACTTGCACGTGTTGCTGGCCTTTGCAATCGTGCCGTCTTCCTAGCTGATCAGCGCAATGTGCCTATCCTCAAGGTGGGTTGATTTATGTTTAAAGGTGTTGTAGTAAACAAATGTCCATCAAGATGCTCTTTATAAAAGACAGAATCAATGCATTGCAGAGAGACACAGCTGGTGATGCCTCCGAGTCTGCCCTCCTGAAGTGTATTGAGCTGTGCTGCGGTTCAGTCAATGAAATGAGAGAGAAGTACACAAAGATTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 363 1024 9 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1456114)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1551534
GRCz11 1 1699328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCACTGCCAAACGAATGGCAAAGAAGAACTGCCTGGTGAAGAATCTT[G/T]AAGCTGTGGAGACTCTTGGATCAACCTCTACCATTTGCTCTGACAAGACT
Long Flanking Sequence:
TCTACCAACTGTGTTGAAGGTGCAAAGACAGTTCACATGTGATAATTAACAGAATTAATGACTTAATTACAAAGTTAAAATATTCAATAGGTACTGCCAGAGGAATTGTCATCAACACTGGTGACCGCACTGTCATGGGTCGCATCGCCACTCTTGCCTCCAGCCTAGAAGGTGGACAGACACCAATTGCTAAAGAGATTGAGCACTTCATCCACATCATCACTGGAGTGGCTGTCTTCTTGGGCGTGTCCTTCTTTATTCTTTCCCTGATTCTTGGATATGGGTGGTTGGAAGCCGTCATCTTCCTGATTGGAATTATTGTCGCCAATGTACCTGAAGGTCTCCTTGCTACTGTAACTGTAAGTGAGAGTACAAACCACACTTGTTGGATATTTGGATATTTGAGCTAAAATAAATACCTAACATGGAACTTTATGTAGGTGTGTCTGACTCTCACTGCCAAACGAATGGCAAAGAAGAACTGCCTGGTGAAGAATCTT[G/T]AAGCTGTGGAGACTCTTGGATCAACCTCTACCATTTGCTCTGACAAGACTGGAACTTTGACCCAGAACCGGATGACCGTCGCTCATATGTGGTTCGACAGCCAGATTCATGAAGCAGACACCACTGAGAACCAGAGTGGAACCACCTTTGACAGGAGCTCTCCTACGTGGTCTGCACTTGCACGTGTTGCTGGCCTTTGCAATCGTGCCGTCTTCCTAGCTGATCAGCGCAATGTGCCTATCCTCAAGGTGGGTTGATTTATGTTTAAAGGTGTTGTAGTAAACAAATGTCCATCAAGATGCTCTTTATAAAAGACAGAATCAATGCATTGCAGAGAGACACAGCTGGTGATGCCTCCGAGTCTGCCCTCCTGAAGTGTATTGAGCTGTGCTGCGGTTCAGTCAATGAAATGAGAGAGAAGTACACAAAGATTGCAGAAATCCCTTTCAACTCCACCAACAAGTATCAGGTATTGTGTATATGTTGTGTTGGTTTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 375 1024 9 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1456152)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1551572
GRCz11 1 1699366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAGAATCTTGAAGCTGTGGAGACTCTTGGATCAACCTCTACCATTTG[C/A]TCTGACAAGACTGGAACTTTGACCCAGAACCGGATGACCGTCGCTCATAT
Long Flanking Sequence:
GTGATAATTAACAGAATTAATGACTTAATTACAAAGTTAAAATATTCAATAGGTACTGCCAGAGGAATTGTCATCAACACTGGTGACCGCACTGTCATGGGTCGCATCGCCACTCTTGCCTCCAGCCTAGAAGGTGGACAGACACCAATTGCTAAAGAGATTGAGCACTTCATCCACATCATCACTGGAGTGGCTGTCTTCTTGGGCGTGTCCTTCTTTATTCTTTCCCTGATTCTTGGATATGGGTGGTTGGAAGCCGTCATCTTCCTGATTGGAATTATTGTCGCCAATGTACCTGAAGGTCTCCTTGCTACTGTAACTGTAAGTGAGAGTACAAACCACACTTGTTGGATATTTGGATATTTGAGCTAAAATAAATACCTAACATGGAACTTTATGTAGGTGTGTCTGACTCTCACTGCCAAACGAATGGCAAAGAAGAACTGCCTGGTGAAGAATCTTGAAGCTGTGGAGACTCTTGGATCAACCTCTACCATTTG[C/A]TCTGACAAGACTGGAACTTTGACCCAGAACCGGATGACCGTCGCTCATATGTGGTTCGACAGCCAGATTCATGAAGCAGACACCACTGAGAACCAGAGTGGAACCACCTTTGACAGGAGCTCTCCTACGTGGTCTGCACTTGCACGTGTTGCTGGCCTTTGCAATCGTGCCGTCTTCCTAGCTGATCAGCGCAATGTGCCTATCCTCAAGGTGGGTTGATTTATGTTTAAAGGTGTTGTAGTAAACAAATGTCCATCAAGATGCTCTTTATAAAAGACAGAATCAATGCATTGCAGAGAGACACAGCTGGTGATGCCTCCGAGTCTGCCCTCCTGAAGTGTATTGAGCTGTGCTGCGGTTCAGTCAATGAAATGAGAGAGAAGTACACAAAGATTGCAGAAATCCCTTTCAACTCCACCAACAAGTATCAGGTATTGTGTATATGTTGTGTTGGTTTTCTATTTGCTGATTTGACTAGCCTTGCTAACAGTGCTGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19396
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 505 1024 11 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1456708)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1552128
GRCz11 1 1699922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTAGCTTTCAATCCACAAGAATCCCAATTCCTCAGAGCCAAAACACT[T/A]GCTTGTGATGAAGGGAGCACCTGAGAGGATCTTGGATCGATGCTCCACCA
Long Flanking Sequence:
TCGACAGCCAGATTCATGAAGCAGACACCACTGAGAACCAGAGTGGAACCACCTTTGACAGGAGCTCTCCTACGTGGTCTGCACTTGCACGTGTTGCTGGCCTTTGCAATCGTGCCGTCTTCCTAGCTGATCAGCGCAATGTGCCTATCCTCAAGGTGGGTTGATTTATGTTTAAAGGTGTTGTAGTAAACAAATGTCCATCAAGATGCTCTTTATAAAAGACAGAATCAATGCATTGCAGAGAGACACAGCTGGTGATGCCTCCGAGTCTGCCCTCCTGAAGTGTATTGAGCTGTGCTGCGGTTCAGTCAATGAAATGAGAGAGAAGTACACAAAGATTGCAGAAATCCCTTTCAACTCCACCAACAAGTATCAGGTATTGTGTATATGTTGTGTTGGTTTTCTATTTGCTGATTTGACTAGCCTTGCTAACAGTGCTGATTCTGCCTTGCTCTAGCTTTCAATCCACAAGAATCCCAATTCCTCAGAGCCAAAACACT[T/A]GCTTGTGATGAAGGGAGCACCTGAGAGGATCTTGGATCGATGCTCCACCATTTTAATTCAGGGAAAACAGCAGCCCTTAGATGAAGAAATGAAAGATGCTTTTCAGAATGCTTATGTTGAACTTGGAGGTCTTGGAGAAAGAGTCCTGGGTAAATTCCCCAAATGAGGTTTATCATTGGAAGTTTTCTGTGTATTAATAACTGAGACTTTTCACACAAGTAAATGTGTTATTTCTCACAGGTTTCTGCCACTTCTGCCTTCCTGATGATCAGTTTCCTGAGGGTTTTGCATTTGATACTGAAGAAGTGAACTTCCCCACTGAGAACCTGTGCTTTGTTGGCCTCATGTCCATGATTGATCCTCCTCGTGCCGCTGTACCAGATGCTGTGGGCAAGTGCAGGAGTGCTGGAATCAAGGTGTTTTTTTCACCTTGATTCAAGACTGATGCCTTGATTATTTTATTCCTGTATTAAATTAATTAGATGATCAAGCATCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 543 1024 11 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1456823)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1552243
GRCz11 1 1700037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGCAGCCCTTAGATGAAGAAATGAAAGATGCTTTTCAGAATGCTTA[T/A]GTTGAACTTGGAGGTCTTGGAGAAAGAGTCCTGGGTAAATTCCCCAAATG
Long Flanking Sequence:
CGTCTTCCTAGCTGATCAGCGCAATGTGCCTATCCTCAAGGTGGGTTGATTTATGTTTAAAGGTGTTGTAGTAAACAAATGTCCATCAAGATGCTCTTTATAAAAGACAGAATCAATGCATTGCAGAGAGACACAGCTGGTGATGCCTCCGAGTCTGCCCTCCTGAAGTGTATTGAGCTGTGCTGCGGTTCAGTCAATGAAATGAGAGAGAAGTACACAAAGATTGCAGAAATCCCTTTCAACTCCACCAACAAGTATCAGGTATTGTGTATATGTTGTGTTGGTTTTCTATTTGCTGATTTGACTAGCCTTGCTAACAGTGCTGATTCTGCCTTGCTCTAGCTTTCAATCCACAAGAATCCCAATTCCTCAGAGCCAAAACACTTGCTTGTGATGAAGGGAGCACCTGAGAGGATCTTGGATCGATGCTCCACCATTTTAATTCAGGGAAAACAGCAGCCCTTAGATGAAGAAATGAAAGATGCTTTTCAGAATGCTTA[T/A]GTTGAACTTGGAGGTCTTGGAGAAAGAGTCCTGGGTAAATTCCCCAAATGAGGTTTATCATTGGAAGTTTTCTGTGTATTAATAACTGAGACTTTTCACACAAGTAAATGTGTTATTTCTCACAGGTTTCTGCCACTTCTGCCTTCCTGATGATCAGTTTCCTGAGGGTTTTGCATTTGATACTGAAGAAGTGAACTTCCCCACTGAGAACCTGTGCTTTGTTGGCCTCATGTCCATGATTGATCCTCCTCGTGCCGCTGTACCAGATGCTGTGGGCAAGTGCAGGAGTGCTGGAATCAAGGTGTTTTTTTCACCTTGATTCAAGACTGATGCCTTGATTATTTTATTCCTGTATTAAATTAATTAGATGATCAAGCATCTATGTCTTCTATCACAGGTTACTTGTGACCATCGATTTACAGCCAAGACTATTGTAAAGGATCTTGAATCAAGATTCAAGTAGTTCTTGATTCAAGATCCGCTGATTGAATATGTCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 672 1024 14 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1457650)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1553070
GRCz11 1 1700864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGTGCCTTTAGAGATGCGAAGGCATGTGTGGTCCATGGAGGAGAACTG[A/T]AAAGTATGAGYGAAGAAGAGCTAGATGATATCCTGAAACACCATACWGAA
Long Flanking Sequence:
CTGATGCCTTGATTATTTTATTCCTGTATTAAATTAATTAGATGATCAAGCATCTATGTCTTCTATCACAGGTTACTTGTGACCATCGATTTACAGCCAAGACTATTGTAAAGGATCTTGAATCAAGATTCAAGTAGTTCTTGATTCAAGATCCGCTGATTGAATATGTCGCACCTTAGTTGCAGCATATTCACTGTGGTTCATACTGGTTGAATTTCTTTCAGTTAATCAAATAATAACTCTGAATCTTATTTACAGGTGATCATGGTTACTGGTGACCATCCAATTACAGCTAAAGCTATTGCAAAAGGTGTCGGCATCATCTCAGAAGGCAATGAGACTGTTGAAGACATTGCCGCTCGTTTGAACATCCCGGTTGGAGAGGTTAATCCAAGGTATGTTAAAGCAAAACTTATGGAGAAGTTTGAATCTAAATGTTTGCTAATACATAGTGTGCCTTTAGAGATGCGAAGGCATGTGTGGTCCATGGAGGAGAACTG[A/T]AAAGTATGAGTGAAGAAGAGCTAGATGATATCCTGAAACACCATACAGAAATTGTGTTCGCCAGAACTTCTCCACAACAAAAGCTGATCATTGTGGAAGGATGTCAGCGACAGGTACCATCAGATATATTCAATTCCTGCTGAGAGTATTTATGCTGCATGAACTCAACGTAATTATTATTTTGTTTACTCTTTCAGGGTGCCATTGTAGCCGTAACCGGTGATGGAGTCAATGATTCTCCAGCTCTGAAGAAGGCTGACATTGGTGTGGCTATGGGTATTGCTGGATCTGACGTATCCAAGCAGGCTGCTGACATGATCCTTCTGGACGACAACTTTGCCTCAATTGTCACTGGAGTAGAAGAAGGTACGACGACCTAAATTAAAAAAAAAATTTAAATGTTACTTTGAAGGTTACTTATTCCTCAAATGTGTCTTTAACTATAGGACGTCTGATCTTTGATAACTTGAAGAAGTCCATTGCCTACACCCTGACAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14454
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 822 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1459898)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1555318
GRCz11 1 1703112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATTGCAAATGTTAAYTATTGTTTAATGTTTCCTCAGGTTCCTGCGATCT[C/A]KTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAGWGACAACCCAGAA
Long Flanking Sequence:
ATATTATTTCTTAAAACAAGACAATATGTTTTGCTTGTCCATAAAACGCTTCTTGATTTAAGAACTTTCAGATATTTGGACTAGAAAAGGGGACAAAAAAAATCTCGGTAAGAAAAGCATTTTTTGCAGTTCAGACACCAACATTGTTTGTCAAAATTTGCTCATAGCACATTTAATGTGTTGTACGCAATGATTATTTTTATAGATATCCACTAAATGTCATTCCAGCAAGGAAGTGTGAGCTTATATTGGCAACCTTTGGATGTCTAAAAGAAAACCTTGTAAAAGGAAATCCAAAGCAATCCCTTTATCTTCCCTAGATGATCTTTGATCCATGCACATGAATTCCTGATGGCTCCCTCGAGTGGTATAAAAGATTAAAGAAATGGTTCACATAATTTCCTTTGAAGCAGCTTGCTTAAATTTGCTGTGATTCCTCCTGCAATGCTGGATTGCAAATGTTAACTATTGTTTAATGTTTCCTCAGGTTCCTGCGATCT[C/A]GTTGGCCTATGAAAGTGCTGAAAGTGACATCATGAAGAGACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATCAGTATGGCCTATGGTCAAATAGGTAAGAGCTTGGTTAATCTAAACAGATGTTTATAGCGGTTTGCTCTGTGTTCAGTCTTTGATCTGGTTCTGAAAAGTAGTACTCTACGGTTCTGTCTGCTTGTTAATTGTGACGTCACGTGAAGCAACTTCCGGGTCCAATCGATATATCAAACTGTATGGGGACACTCAACAAATGCTAATACTAAATGTTTACCAGAAACATTTATGGTAAATGTGCTCAGGTGCTCTGGTTTCCCCCACAATCCAAACGCATGCTCTATAGGGGAATTGAATGAGCTAATTCAGTCGTAGTGTATGTGTGTGAATGTGAGCGTGTATGGATGTTTCCTAGTACTGGGTTGCAGCTGGAAGGGCATCAGCTGCGTAAAACATATGCTAGATAAGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 835 1024 17 22
ENSDART00000048828 Nonsense 835 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1459936)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1555356
GRCz11 1 1703150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGCGATCTMKTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATC
Long Flanking Sequence:
CCATAAAACGCTTCTTGATTTAAGAACTTTCAGATATTTGGACTAGAAAAGGGGACAAAAAAAATCTCGGTAAGAAAAGCATTTTTTGCAGTTCAGACACCAACATTGTTTGTCAAAATTTGCTCATAGCACATTTAATGTGTTGTACGCAATGATTATTTTTATAGATATCCACTAAATGTCATTCCAGCAAGGAAGTGTGAGCTTATATTGGCAACCTTTGGATGTCTAAAAGAAAACCTTGTAAAAGGAAATCCAAAGCAATCCCTTTATCTTCCCTAGATGATCTTTGATCCATGCACATGAATTCCTGATGGCTCCCTCGAGTGGTATAAAAGATTAAAGAAATGGTTCACATAATTTCCTTTGAAGCAGCTTGCTTAAATTTGCTGTGATTCCTCCTGCAATGCTGGATTGCAAATGTTAACTATTGTTTAATGTTTCCTCAGGTTCCTGCGATCTCGTTGGCCTATGAAAGTGCTGAAAGTGACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATCAGTATGGCCTATGGTCAAATAGGTAAGAGCTTGGTTAATCTAAACAGATGTTTATAGCGGTTTGCTCTGTGTTCAGTCTTTGATCTGGTTCTGAAAAGTAGTACTCTACGGTTCTGTCTGCTTGTTAATTGTGACGTCACGTGAAGCAACTTCCGGGTCCAATCGATATATCAAACTGTATGGGGACACTCAACAAATGCTAATACTAAATGTTTACCAGAAACATTTATGGTAAATGTGCTCAGGTGCTCTGGTTTCCCCCACAATCCAAACGCATGCTCTATAGGGGAATTGAATGAGCTAATTCAGTCGTAGTGTATGTGTGTGAATGTGAGCGTGTATGGATGTTTCCTAGTACTGGGTTGCAGCTGGAAGGGCATCAGCTGCGTAAAACATATGCTAGATAAGTTGGTGGTTCATTCCGCTGTGGCGATCCCTGATAAATAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14079
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 835 1024 17 22
ENSDART00000048828 Nonsense 835 1024 17 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1459936)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1555356
GRCz11 1 1703150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGCGATCTMKTTGGCCTMTGAAAGTGCWGAAAGTRACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATC
Long Flanking Sequence:
CCATAAAACGCTTCTTGATTTAAGAACTTTCAGATATTTGGACTAGAAAAGGGGACAAAAAAAATCTCGGTAAGAAAAGCATTTTTTGCAGTTCAGACACCAACATTGTTTGTCAAAATTTGCTCATAGCACATTTAATGTGTTGTACGCAATGATTATTTTTATAGATATCCACTAAATGTCATTCCAGCAAGGAAGTGTGAGCTTATATTGGCAACCTTTGGATGTCTAAAAGAAAACCTTGTAAAAGGAAATCCAAAGCAATCCCTTTATCTTCCCTAGATGATCTTTGATCCATGCACATGAATTCCTGATGGCTCCCTCGAGTGGTATAAAAGATTAAAGAAATGGTTCACATAATTTCCTTTGAAGCAGCTTGCTTAAATTTGCTGTGATTCCTCCTGCAATGCTGGATTGCAAATGTTAACTATTGTTTAATGTTTCCTCAGGTTCCTGCGATCTCGTTGGCCTATGAAAGTGCTGAAAGTGACATCATGAAG[A/T]GACAACCCAGAAATGCTAAAACAGATAAACTGGTGAACGAGAGGCTGATCAGTATGGCCTATGGTCAAATAGGTAAGAGCTTGGTTAATCTAAACAGATGTTTATAGCGGTTTGCTCTGTGTTCAGTCTTTGATCTGGTTCTGAAAAGTAGTACTCTACGGTTCTGTCTGCTTGTTAATTGTGACGTCACGTGAAGCAACTTCCGGGTCCAATCGATATATCAAACTGTATGGGGACACTCAACAAATGCTAATACTAAATGTTTACCAGAAACATTTATGGTAAATGTGCTCAGGTGCTCTGGTTTCCCCCACAATCCAAACGCATGCTCTATAGGGGAATTGAATGAGCTAATTCAGTCGTAGTGTATGTGTGTGAATGTGAGCGTGTATGGATGTTTCCTAGTACTGGGTTGCAGCTGGAAGGGCATCAGCTGCGTAAAACATATGCTAGATAAGTTGGTGGTTCATTCCGCTGTGGCGATCCCTGATAAATAAAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3340
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 912 1024 19 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1460931)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1556351
GRCz11 1 1704145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCATGTAAACATTGCTCGTCTGTTTATGTTCCTAGACATACGAGCGC[A/T]GAAAGATTGTGGAGTTCACATGCCACACAGCCTTCTTCGCCAGTATTGTG
Long Flanking Sequence:
TAAAGGAATTAAGCTGAAGGAAAATGAATGAATGAATGAAAATGCCTAAGAGTTTGTTGTATGAACGGCGCCACCTAGTGTTTCTTCAAAAATCCCATTAATTAAATTGGAATGCTCTGGATTTTGATGTGTGAATTTAAAACAATACATATAAATATAAAGAAAACTAACATGTGTAAATGAGCACTTAATTACAAACTCAAACCCACAGATAGACGCTTTCATTTTAATGTCATCGTACTTATTTTTAGGTATGATGCAAGCAGTCGCAGGGTTCTTTTCCTACTTTGTAATTCTCGCCGAAAACGGATTCCTCCCCTCCGATTTAGTAGGAATCCGAGTCAACTGGGATGACAAATATGTCAATGATCTGGAAGACAGCTATGGCCAGCAATGGGTGAGGTGCCTCTATAAACCAAAATCGTCTCTGATGTAAAAAATGTAAAGCATAAATCATGTAAACATTGCTCGTCTGTTTATGTTCCTAGACATACGAGCGC[A/T]GAAAGATTGTGGAGTTCACATGCCACACAGCCTTCTTCGCCAGTATTGTGATTGTGCAGTGGGCAGATCTGATCATCTGTAAGACCAGGAGGAATTCCATTGTACAGCAGGGAATGAGGTACAGGACTGTGCAAAAGTTTTGGCCCCTCCGTTACTTTTGTGGTTTTAGTGAGGGTATGATGACTTTATATAGTATTTCTCATTCTCTTTTTTTAAAATACAATTAGAAAATACACAGGTTTTTTGGGGGGTGTAATTGTTTAAGACGTGAAGATGGAAGATGGAAGAATGGCTGAAGTATGACTGAACAATACTGGATGTTCTGTCTTGGTTTGATCTGCATTTTTGCCAGAGCTGTTGGCAATATTGCCTGAATTGATGGGGATTGTGAATGCTGAAAAGTACAGACAGGTTTTAAACCATCATGTAATTGAAAAACAGTGATGAAATGGCCTCCACAGAGTCCAGACCTAAATATTATATGCAGTATGAGATTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39529
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048828 Nonsense 1002 1024 21 22

The following transcripts of ENSDARG00000001870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 1462633)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1558053
GRCz11 1 1705847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTGCTGGTGGTTCTGCGCCTTCCCATATTCACTTCTCATCTTCGTCTA[T/A]GATGAAGCTAGAAGATATATCCTTAGGCGGAGCCCAGGAGGTAATAACAG
Long Flanking Sequence:
GATGTATAGATAGATAGATAGATAGATAGATGTATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATTTGGCAAAAGTCTTAGCCCCGCAAAGCTGGTGGTGGCTTGAGATATTTGCACAGTGCTATAATTAAACTGTATAATTTAAGGATTATTTTAAGGAGCACATCCTAATGTCCAACATTATTCTTTCTTAGAAACAAAATCCTCATCTTCGGCCTGTTTGAAGAAACTGCTCTTGCAGCATTTCTGTCCTACTGCCCAGGCATGGACGTAGCTTTGAGGATGTATCCGCTCAAGTAGGTGGACTTAACTAGCATTCAGCATTCAAGAAACTGTGTAGGTGATCTCGAAAGCCATATTGCAACACTGTTATTATCTTTTAGACCGTGCTGGTGGTTCTGCGCCTTCCCATATTCACTTCTCATCTTCGTCTA[T/A]GATGAAGCTAGAAGATATATCCTTAGGCGGAGCCCAGGAGGTAATAACAGATATAAATAACAGATGTCGGCTCACTCTGACAATGATGATAACTGTGTTTGTTTTCATTTTAAAGCCACCATATCTGCTTGCCCAGTGGATGGATGTTTTTTTGGCTCTAATATCTGTGATGTGTTTTGTGTTTCAGGTTGGGTGGAACAAGAAACATACTACTAAAACATGAAGCAAACATTTTCAAGGAGACACATATCAATATATTTTTAAATGATACTGAATCTGGCCATTTTCAGTCAATAAAGCTGTTGAAGTGGACTAAGCTTGTTTTTGTGTGCTCAATAAGCTAATGGTTTTGAAAAGACGTCAATGGAAAAGTGACGTTTTACATTAAGCCACAAATTGTAGATTTACATAAAATATTGAGATTAAATTAGTTTATAAATACATTACTCAGCTAGAACAATCCCTTTTAGTGATTCATTACAAGATGAATTCTTCAGGTG
Associated Phenotype:
Not determined