Busch Lab

ZMP

si:ch211-223p8.5

Ensembl ID:
ENSDARG00000001825
ZFIN ID:
ZDB-GENE-080815-3
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZD03]
Human Orthologue:
C10orf79
Human Description:
chromosome 10 open reading frame 79 [Source:HGNC Symbol;Acc:26684]
Mouse Orthologue:
D19Ertd652e
Mouse Description:
DNA segment, Chr 19, ERATO Doi 652, expressed Gene [Source:MGI Symbol;Acc:MGI:1289258]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22296 Nonsense Available for shipment Available now
sa35482 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22297 Nonsense Available for shipment Available now
sa35483 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22296
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Nonsense 48 1642 2 38
ENSDART00000147713 Nonsense 57 1651 2 38
Genomic Location (Zv9):
Chromosome 13 (position 24942209)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24587869
GRCz11 13 24718319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTGCTACACCTGCGGAAACTTCATCGTTTTCCTCAATGTGGAAACT[A/T]AAGAGAGGAAGACGCTGCAGAGTCCCGGCTCTGGTATTGGAGCATTTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28111
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Nonsense 71 1642 2 38
ENSDART00000147713 Nonsense 80 1651 2 38
Genomic Location (Zv9):
Chromosome 13 (position 24942280)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24587940
GRCz11 13 24718390
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCCGGCTCTGGTATTGGAGCATTTACAGCCAGTGGGCAACGTAGGTG[T/A]ATTGCTTTCTCTGATCTCGGACTCAAGCCTTCCATCTTTATCTACAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Essential Splice Site 362 1642 9 38
ENSDART00000147713 Essential Splice Site 371 1651 9 38
Genomic Location (Zv9):
Chromosome 13 (position 24945358)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24591018
GRCz11 13 24721468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAGGAAATTCACGAGAATGCTTAAAATCTTTTAGTTTTCTTTCTT[A/C]GGGCTGTGTTTACAGATTCAAACCACTGCTAAAGGATAAAGCTGTCAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4503
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Essential Splice Site 758 1642 17 38
ENSDART00000147713 Essential Splice Site 767 1651 17 38
Genomic Location (Zv9):
Chromosome 13 (position 24950300)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24595960
GRCz11 13 24726410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGTCCTCACCAAAATGACCGACCGGGATTCATTTCATACAGGAGAGG[T/C]ATAGAAACACAGCATTTTCTATCGTTTAAATAATATTTAGACACAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22297
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Nonsense 1291 1642 31 38
ENSDART00000147713 Nonsense 1300 1651 31 38
Genomic Location (Zv9):
Chromosome 13 (position 24961211)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24606871
GRCz11 13 24737321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTTTATGATGTCCCTGGACACTCAATTGACCAGCTATATAAACTTTA[C/A]AAACGCAGACCAAGGTATTATTTCAGAAGATTTGCAGCTTGTTTGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35483
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002858 Essential Splice Site 1360 1642 32 38
ENSDART00000147713 Essential Splice Site 1369 1651 32 38
Genomic Location (Zv9):
Chromosome 13 (position 24961499)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24607159
GRCz11 13 24737609
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGAGGTTTTGCCTGGCAAGACGGGCCAAAGTGGAAAGTGAACAAAAG[G/A]TAAGAATAGCTAGATAAGCTAAATGTCACCCTAATCAAATTTCTAAAGAG
Associated Phenotype:
Not determined