Busch Lab

ZMP

si:ch211-140f21.1

Ensembl ID:
ENSDARG00000001818
ZFIN ID:
ZDB-GENE-030131-3063
Description:
complement component 3-like isoform 2 [Source:RefSeq peptide;Acc:NP_001108152]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa30732 Nonsense Mutation detected in F1 DNA Not yet available
sa31073 Nonsense Mutation detected in F1 DNA Not yet available
sa43860 Nonsense Mutation detected in F1 DNA Not yet available
sa43859 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32403 Essential Splice Site Available for shipment Available now
sa30731 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30732
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 None None 1690 None 40
ENSDART00000110577 Nonsense 7 323 1 11
ENSDART00000111875 None None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827416)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216272
GRCz11 22 26236169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATATTGAGTGGCGGTTACTTCAGCAGGACGATGCTTCTTCAGCTGCTGT[T/A]ATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31073
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 None None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875 None None 323 None 11
ENSDART00000108737 None None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875 None None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
GRCz11 22 26236119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43860
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 None None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875 None None 323 None 11
ENSDART00000108737 None None 1690 None 40
ENSDART00000110577 Nonsense 24 323 1 11
ENSDART00000111875 None None 323 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
GRCz11 22 26236119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43859
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 46 1690 3 40
ENSDART00000110577 Essential Splice Site 46 323 3 11
ENSDART00000111875 Essential Splice Site 46 323 3 11
Genomic Location (Zv9):
Chromosome 22 (position 26765346)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26154202
GRCz11 22 26174099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTGTGTTTTTCTGTTTACAGTGAGCCGGTCAAAGACCCTTCTCCGTCG[T/C]GAGTAATTGTCCTCTGCCCTCAGTAAACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 247 1690 8 40
ENSDART00000110577 Essential Splice Site 247 323 8 11
ENSDART00000111875 Essential Splice Site 247 323 8 11
Genomic Location (Zv9):
Chromosome 22 (position 26756774)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26145630
GRCz11 22 26165527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGAAAAGAGAATGTTTTCAGCAGAGAGTTTGAAGTGAAGAAATATGG[T/G]AATTATATTACCTTCAGATTTGTTTCTTCTACATATTTTTTTCTCTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4184
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 1083 1690 26 40
ENSDART00000110577 None None 323 None 11
ENSDART00000111875 None None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26732074)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26120930
GRCz11 22 26140827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCAGACGACTCGTACCCTCCCTACGCCAATGAAGGCACCAGCACATGG[T/A]ATTGATACTGACACAAGAATAATAACAGCTTTACATTGAAACTTTCTCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29804
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 1277 1690 31 40
ENSDART00000110577 None None 323 None 11
ENSDART00000111875 None None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26726919)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26115775
GRCz11 22 26135672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTAGTTGTGGTTCATTTGTTTTCATATAATAATCATATTCCTCCATC[A/G]GTCCACCATGGTGGTTCTTCAGGCCCTGTCTGAGTATCTAGTGAAGAGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7990
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Nonsense 1420 1690 34 40
ENSDART00000110577 None None 323 None 11
ENSDART00000111875 None None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26725819)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26114675
GRCz11 22 26134572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTCTRGACATCGGCCTGCCTACAGGCTTTGAACCTGAAAACKCTGATT[T/G]AGAGTTGGTAAGACCAAACTCATATGRCGTAACATTGTACAGAAGCTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3199
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Essential Splice Site 1452 1690 35 40
ENSDART00000110577 None None 323 None 11
ENSDART00000111875 None None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26725101)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26113957
GRCz11 22 26133854
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGGACAACCTKAGCGACAGAGGATCCCTCATTATTCACCTGTTCAAGG[T/A]AACCTAACAAGAACTTTTGACTTASNNNNNATGCCTTGTTAATATGCTGYAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30731
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108737 Nonsense 1506 1690 37 40
ENSDART00000110577 None None 323 None 11
ENSDART00000111875 None None 323 None 11
Genomic Location (Zv9):
Chromosome 22 (position 26723665)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26112521
GRCz11 22 26132418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCTGTAGCAGGTTCTACTCTCCTCCTGAAGACAAACAGCAGCTGGAT[C/T]AGATCTGTGAAGGCGACGTGTGCCGCTGCTCGCAGGGTCAGTCTCTTTGT
Associated Phenotype:
Not determined