Busch Lab

ZMP

atp5o

Ensembl ID:
ENSDARG00000001788
ZFIN ID:
ZDB-GENE-050522-147
Description:
ATP synthase subunit O, mitochondrial [Source:RefSeq peptide;Acc:NP_001003843]
Human Orthologues:
AP000304.12, ATP5O
Human Description:
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit [Source:HGNC Symbol;Acc:850]
Mouse Orthologues:
Atp5o, Gm5436
Mouse Descriptions:
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene [Source:MGI Symbol;Acc:MGI:1
predicted pseudogene 5436 Pseudogene [Source:MGI Symbol;Acc:MGI:3643291]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17805 Essential Splice Site Available for shipment Available now
sa21522 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17805
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005879 Essential Splice Site 9 209 None 7

The following transcripts of ENSDARG00000001788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34178923)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33334869
GRCz11 9 33145615
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTACACAGTCGCAGGAGAAAATGGCAGCGCTTGGAGTGGGGCTGCAGG[T/C]ATGACTTTCTGAAAACCTTGTACTCGCTTTATAGAAAATCAACAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005879 Nonsense 133 209 5 7

The following transcripts of ENSDARG00000001788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34180609)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33336555
GRCz11 9 33147301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTGACCCCTGATGTCATCGCTGCTTTTAGCAAAATGATGAGCGCCCAC[A/T]GAGGAGAGGTCACATGCTCAGTCACCACCGCTCAGGTAAGCGTTATATAA
Associated Phenotype:
Not determined