Busch Lab

ZMP

tnxb

Ensembl ID:
ENSDARG00000001760
ZFIN ID:
ZDB-GENE-070103-5
Human Orthologue:
TNXB
Human Description:
tenascin XB [Source:HGNC Symbol;Acc:11976]
Mouse Orthologue:
Tnxb
Mouse Description:
tenascin XB Gene [Source:MGI Symbol;Acc:MGI:1932137]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42693 Nonsense Mutation detected in F1 DNA Not yet available
sa39089 Nonsense Mutation detected in F1 DNA Not yet available
sa12917 Nonsense Available for shipment Available now
sa39088 Nonsense Mutation detected in F1 DNA Not yet available
sa22795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 623 2285 1 14
ENSDART00000132368 None None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18689202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16738950
GRCz11 16 16646927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCTTCAAAGCCTGAGGTGGACACCACACAGAAACCTGTCCAAAGTGTA[C/T]AAAACACAATTGGTGACAAGAAAAATTCTACCACTGAGTCTATAGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39089
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 698 2285 1 14
ENSDART00000132368 None None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18688977)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16738725
GRCz11 16 16646702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGTCAAGAAACCTATCCAAAGTCTACAAAACAAAATTGGTGACAAG[A/T]AAAATTCTACTACTAAGTCAACAGTCAACACTATTAACATTCAGAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1467 2285 3 14
ENSDART00000132368 None None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18683927)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16733671
GRCz11 16 16641648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACTGTGACTATGAAGATGTCCAGTGCCATGCCAGACMCAAAAACTGWC[A/T]AGACAAGGCCAGACAAGGCAATTTTAGTGAAAGAGACAGTTACAAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39088
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1608 2285 3 14
ENSDART00000132368 None None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18683504)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16733248
GRCz11 16 16641225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACTCGGTCCAAGACAAAGATTACTACAAGAACTGCAGGAGATCAAGGG[G/T]AAGAAAGCAAGACCAATGCTGTCTCTGCTGAAAAAGACGAGAAGTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22795
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014439 Nonsense 1941 2285 7 14
ENSDART00000132368 None None 389 None 9
Genomic Location (Zv9):
Chromosome 16 (position 18671716)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16721515
GRCz11 16 16629492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGACTTTATCTGGCAGTTCTGTGGAGCACCAGCTTAGAGCACTTCAT[A/T]GATCTTCTTTATACATGGTGAAAATGACAAGTCAAGTCAACAGGCTCCAG
Associated Phenotype:
Not determined