Busch Lab

ZMP

strn3

Ensembl ID:
ENSDARG00000001729
ZFIN ID:
ZDB-GENE-030616-405
Description:
striatin, calmodulin binding protein 3 [Source:RefSeq peptide;Acc:NP_001013284]
Human Orthologue:
STRN3
Human Description:
striatin, calmodulin binding protein 3 [Source:HGNC Symbol;Acc:15720]
Mouse Orthologue:
Strn3
Mouse Description:
striatin, calmodulin binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:2151064]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23096 Nonsense Available for shipment Available now
sa32155 Nonsense Available for shipment Available now
sa16391 Essential Splice Site Available for shipment Available now
sa23097 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23096
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126967 Nonsense 4 719 1 16
Genomic Location (Zv9):
Chromosome 17 (position 28766253)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28690180
GRCz11 17 28707143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATCGGCGACTTCTAGCAGGACTTTCCTATTTTTAAACATGGATGAA[C/T]AGCCCGGAGGAGGAGGAGGTGGTGGTGGTGGAGGAGGAGGAGGAGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32155
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126967 Nonsense 144 719 3 16
Genomic Location (Zv9):
Chromosome 17 (position 28781590)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28705517
GRCz11 17 28722480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTCTAGAGCAAAATACCATAAATTAAAATATGGGACAGAACTTAAT[C/T]AAGGTGAAGTGAAAATGCCTAGCTTTGAATCAGGTAAGAGGACCCAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16391
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126967 Essential Splice Site 551 719 12 16
ENSDART00000126967 Essential Splice Site 551 719 12 16
Genomic Location (Zv9):
Chromosome 17 (position 28797604)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28721531
GRCz11 17 28738494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCCTCAAGAGAAGATCCCGTGTCTYAGCACTTTTAACTCYGATAAAG[G/A]TRAGCACTGTGCRTCTTGWGTATTATGCTAAATAAKGGTTTTTATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126967 Essential Splice Site 551 719 12 16
ENSDART00000126967 Essential Splice Site 551 719 12 16
Genomic Location (Zv9):
Chromosome 17 (position 28797604)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28721531
GRCz11 17 28738494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCCTCAAGAGAAGATCCCGTGTCTTAGCACTTTTAACTCTGATAAAG[G/T]TGAGCACTGTGCGTCTTGAGTATTATGCTAAATAAGGGTTTTTATTTTGT
Associated Phenotype:
Not determined