Busch Lab

ZMP

LOC796753

Ensembl ID:
ENSDARG00000001712
Human Orthologues:
KCNMB1, KCNMB2
Human Descriptions:
potassium large conductance calcium-activated channel, subfamily M, beta member 1 [Source:HGNC Symbo
potassium large conductance calcium-activated channel, subfamily M, beta member 2 [Source:HGNC Symbo
Mouse Orthologues:
Kcnmb1, Kcnmb2
Mouse Descriptions:
potassium large conductance calcium-activated channel, subfamily M, beta member 1 Gene [Source:MGI S
potassium large conductance calcium-activated channel, subfamily M, beta member 2 Gene [Source:MGI S

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35026 Nonsense Mutation detected in F1 DNA Not yet available
sa35025 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21852 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35026
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Nonsense 31 234 2 4
Genomic Location (Zv9):
Chromosome 11 (position 8398851)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8306758
GRCz11 11 8316687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTCCCTTAAGCAGGACGATTTATCAGAAGATTCGAGAGTATGATATTT[T/A]GGAGAAGAGGAGGACGGTGACCGCGCTGAAGGCTGGAGAGGACAGAGCCA
Long Flanking Sequence:
TTGAGGTATGCATTAGCATAGGTTTCATCGAACAAACTAGATTCTGACGTAAGCTATTCGCAGGAAGTGGGCTGAGATTTTGTAATGCTTTTGACTACACTCACAGTAATTATCAAAAGGTCACTGATAAAGATAGACAGGTTAGACAGCTTGCCTTCATATCCATGCATAATCTTCAAAAGCAATTCAACCTGCTGTTAAAATACGATTAAAGAATCATGAGCTAAATATTTGGAAAGGAACTTATTATGCATATGCAATTGGACAGTAGCAGAGTGTCATTAGTTTGAGTTTATAAACCATTCACCCTTGAACTTAAACCTTTTTTTTTTGACAAAAACTGTTGAACTTATTATAATATACTATTTCATTATATTAGGTCATGGACACACCATGTTTTTATTAATCCATGATGATTTTTTTAAATTCTTTGTGCATCTTTCGATCGTTGTGTCCCTTAAGCAGGACGATTTATCAGAAGATTCGAGAGTATGATATTT[T/A]GGAGAAGAGGAGGACGGTGACCGCGCTGAAGGCTGGAGAGGACAGAGCCATTCTCTTAGGCCTCAGCATGATCCTATGCTCCGCCATGATGTACTTTGTGTTGGGCATCACAATGGTGCGTTCTTACTCAGACAGGTAAGGATGGCCATTACCCACTCATGTAGAGAAATGCATACACTGAAAGCCAAAGTAAATATGACTCACGATTCAGCCTACAATTTTGTGAAACCACAAAAATGTACTTAAACATACACTACCTGACAAAAGTCATGTCGTTGATCCCAGTTGTGAGAGCAAGAAATACTATCTTAAGTTCTAGTTGATCATTTGGAAAAGTGGCAGATGGTAGAATTTTTTCAATGAATCATCTGATGAACTGCATCCCAATCATCACCAATACTGCAGAAGACCAATTGGAACCTGCAAGGACCCAAGATTCTCACAGAAATCAGTCAAGTAAAGGTAAAGTCATGATTTGGGGTTACATTTAGTATGGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Essential Splice Site 141 234 4 4
Genomic Location (Zv9):
Chromosome 11 (position 8389150)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8297057
GRCz11 11 8306986
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTTAAGGCAGCAAGCATTATTTACAGTGGATTTCTTTCTTCCCCTGC[A/T]GTGTTTTTACATCCCAAAGTGCCGAAAGGAGCAAACACTAATGCACACCA
Long Flanking Sequence:
TATTGGTTGGGCTTAGATCAGTCTTTTGCTTGGTGATCTGTACCATAGGAAATACCTTCTCATAGACATGTACAAAATAGGTGTGTATCTGAAATGTACAACAACATGTATTTCAGTTTTGCAAAACTGTAAACAGCGCCCTTTAGTAGATTGGTCATCTAAAAAGTGCAATAAAACATACCTGTATTTTATGTTTCGCAAACAAATTAAGCTAAGGCACACATTTTTAATAAGCCTGGGATAAGTATAAGACACAAAATGGCATTACCAAATACTTCCAAATAAATCCACACTGCAAAAAGTCTTATGCAAAAAGTCAAGACAACAAATATGTTCATGTTCCGTTAACTTATTTTAATAAGTTAATCAGGCTTCAACTAAATTTTGTAAGTTATACAAAATTTAACTCATTATTTTTAGTCTGTTTGATTGATGTAAGTACATTTTCTTCAATTTAAGGCAGCAAGCATTATTTACAGTGGATTTCTTTCTTCCCCTGC[A/T]GTGTTTTTACATCCCAAAGTGCCGAAAGGAGCAAACACTAATGCACACCATAGTGATGAACATCTCGGAGCGGCTCAAGATGCACCAGCAGGTTCTGTGTTATTATGACCCCTCAGAGCAGCAGGACGGCGTACTTCTGACACGTCTCTACGGCCGCGGAGCGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGTCGGGGGAACGCTTATCATCGCAATGGTGAAGCTCACTCAATACCTGTCCTTCCTGTGCGAGCAGATCAGCCGCATTAAAAGGTGAGACTGACGGTGTGCAGATGGATACTTCAAGCCAGAGAGACTGATGCTTGTTAAGAAACATCTAATCGCTCTGTTCTTTGCAGGATGGGGCTTTACTCCTTAAGAGGAGCTTCTCATGCTCAGGTCTGCACCCGGAAGTTTAACGGCGGCATCCAGGATGTGGTTTGATATGCGAATTTGGACCTGTCTCCTACTCAACAAAGTGTTTTGCCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5787
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Nonsense 148 234 4 4
Genomic Location (Zv9):
Chromosome 11 (position 8389127)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8297034
GRCz11 11 8306963
KASP Assay ID:
554-3554.1 (used for ordering genotyping assays)
KASP Sequence:
TTACAGTGGATTTMTTTCTTCCCCTGCAGTGTTTTTACATCCCAAAGTGC[C/T]GAAAGGAGCARACACTAATGCACACCATAGTGATGAACATCTCGGAGCGG
Long Flanking Sequence:
TTTTGCTTGGTGATCTGTACCATAGGAAATACCTTCTCATAGACATGTACAAAATAGGTGTGTATCTGAAATGTACAACAACATGTATTTCAGTTTTGCAAAACTGTAAACAGCGCCCTTTAGTAGATTGGTCATCTAAAAAGTGCAATAAAACATACCTGTATTTTATGTTTCGCAAACAAATTAAGCTAAGGCACACATTTTTAATAAGCCTGGGATAAGTATAAGACACAAAATGGCATTACCAAATACTTCCAAATAAATCCACACTGCAAAAAGTCTTATGCAAAAAGTCAAGACAACAAATATGTTCATGTTCCGTTAACTTATTTTAATAAGTTAATCAGGCTTCAACTAAATTTTGTAAGTTATACAAAATTTAACTCATTATTTTTAGTCTGTTTGATTGATGTAAGTACATTTTCTTCAATTTAAGGCAGCAAGCATTATTTACAGTGGATTTCTTTCTTCCCCTGCAGTGTTTTTACATCCCAAAGTGC[C/T]GAAAGGAGCAAACACTAATGCACACCATAGTGATGAACATCTCGGAGCGGCTCAAGATGCACCAGCAGGTTCTGTGTTATTATGACCCCTCAGAGCAGCAGGACGGCGTACTTCTGACACGTCTCTACGGCCGCGGAGCGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGTCGGGGGAACGCTTATCATCGCAATGGTGAAGCTCACTCAATACCTGTCCTTCCTGTGCGAGCAGATCAGCCGCATTAAAAGGTGAGACTGACGGTGTGCAGATGGATACTTCAAGCCAGAGAGACTGATGCTTGTTAAGAAACATCTAATCGCTCTGTTCTTTGCAGGATGGGGCTTTACTCCTTAAGAGGAGCTTCTCATGCTCAGGTCTGCACCCGGAAGTTTAACGGCGGCATCCAGGATGTGGTTTGATATGCGAATTTGGACCTGTCTCCTACTCAACAAAGTGTTTTGCCTGTTATGTTGTCTTCCTCCTGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21852
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052698 Nonsense 190 234 4 4
Genomic Location (Zv9):
Chromosome 11 (position 8388999)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 8296906
GRCz11 11 8306835
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATGACCCCTCAGAGCAGCAGGACGGCGTACTTCTGACACGTCTCTA[C/A]GGCCGCGGAGCGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGT
Long Flanking Sequence:
TGGTCATCTAAAAAGTGCAATAAAACATACCTGTATTTTATGTTTCGCAAACAAATTAAGCTAAGGCACACATTTTTAATAAGCCTGGGATAAGTATAAGACACAAAATGGCATTACCAAATACTTCCAAATAAATCCACACTGCAAAAAGTCTTATGCAAAAAGTCAAGACAACAAATATGTTCATGTTCCGTTAACTTATTTTAATAAGTTAATCAGGCTTCAACTAAATTTTGTAAGTTATACAAAATTTAACTCATTATTTTTAGTCTGTTTGATTGATGTAAGTACATTTTCTTCAATTTAAGGCAGCAAGCATTATTTACAGTGGATTTCTTTCTTCCCCTGCAGTGTTTTTACATCCCAAAGTGCCGAAAGGAGCAAACACTAATGCACACCATAGTGATGAACATCTCGGAGCGGCTCAAGATGCACCAGCAGGTTCTGTGTTATTATGACCCCTCAGAGCAGCAGGACGGCGTACTTCTGACACGTCTCTA[C/A]GGCCGCGGAGCGATCATCAGCTCGCTCCTTTGGCCCACATGCACCCTTGTCGGGGGAACGCTTATCATCGCAATGGTGAAGCTCACTCAATACCTGTCCTTCCTGTGCGAGCAGATCAGCCGCATTAAAAGGTGAGACTGACGGTGTGCAGATGGATACTTCAAGCCAGAGAGACTGATGCTTGTTAAGAAACATCTAATCGCTCTGTTCTTTGCAGGATGGGGCTTTACTCCTTAAGAGGAGCTTCTCATGCTCAGGTCTGCACCCGGAAGTTTAACGGCGGCATCCAGGATGTGGTTTGATATGCGAATTTGGACCTGTCTCCTACTCAACAAAGTGTTTTGCCTGTTATGTTGTCTTCCTCCTGCTTTGTCCATCTGTCCGGGTTGTGCTGACAAGGATGGAGTATTTTTATTTGTATTTTTTTGTGAATGAAAACTTCTTGAGGATCAATAGAGCCCCTAGTATTTGGAACTTCATGCTACCAGACTGGGTCAAGT
Associated Phenotype:
Not determined