Busch Lab

ZMP

kirrela

Ensembl ID:
ENSDARG00000001634
ZFIN ID:
ZDB-GENE-040426-2126
Description:
kin of IRRE like a [Source:RefSeq peptide;Acc:NP_998033]
Human Orthologue:
KIRREL
Human Description:
kin of IRRE like (Drosophila) [Source:HGNC Symbol;Acc:15734]
Mouse Orthologue:
Kirrel
Mouse Description:
kin of IRRE like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891396]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5404
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009695 Essential Splice Site 16 807 1 16
ENSDART00000109396 Essential Splice Site 16 807 1 15
ENSDART00000142924 Essential Splice Site 16 497 1 11
Genomic Location (Zv9):
Chromosome 7 (position 20357805)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18894436
GRCz11 7 19146703
KASP Assay ID:
2259-8627.1 (used for ordering genotyping assays)
KASP Sequence:
CAYGCAGGGTCTGCTGCTGCTTCTGAGTTTGGCGTTGAGTTTTCACAGAG[G/A]TAAGAGACTCGCTCGGCTTCATGAAGTTGTGTTTGTGTGAGCATTTCTTT
Associated Phenotype:
Not determined