Busch Lab

ZMP

tomm34

Ensembl ID:
ENSDARG00000001557
ZFIN ID:
ZDB-GENE-030131-2081
Description:
mitochondrial import receptor subunit TOM34 [Source:RefSeq peptide;Acc:NP_955932]
Human Orthologue:
TOMM34
Human Description:
translocase of outer mitochondrial membrane 34 [Source:HGNC Symbol;Acc:15746]
Mouse Orthologue:
Tomm34
Mouse Description:
translocase of outer mitochondrial membrane 34 Gene [Source:MGI Symbol;Acc:MGI:1914395]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2296 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2326
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001803 Essential Splice Site None 305 2 8

The following transcripts of ENSDARG00000001557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 52185138)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52234320
GRCz11 6 52234319
KASP Assay ID:
554-3408.1 (used for ordering genotyping assays)
KASP Sequence:
AACATTTTAAGYATACAGCAGKTAATGTTTACAGTAACTTTGATCGTTAC[A/T]GTGTTAACATGCCTCAGAAGCGGCGCACGCAGTCGTGGACGGATCTCAAA
Long Flanking Sequence:
ACGTTCTTAAGTTTATATCAGACCAACTAATTTCTTCTCTACCACGATTTGGCAACACTGGATTGGGTTACAACCATCCGTCCCGTTCTTCAAATAGCAGCTCCGAGGCTCGACAGCCGCTTCAGTCCCGAAAACTGAAACTGAAATTTAATACCGCCCGTTTCATTAGACACACAGCCGGTAAAACGTGGTGCTCATCCCGACTAGCGTGTGTGTGAAAGGCGGAGAAGAGAATTTCTAGCATGTTCTAGGAGGAGGACGGACTGGTTATCTAGTATAGGTCTCTAGCTCGTTGTTAAATACAGTAACTGCTAACTTTAAACAGCCGATCACTAAAGCTCTTCCTTCAGCCTTTACTTTCCGGGTTTTTCCACCAACACGATTCTATAGGGTAACTTTTTGTTTCGTTTATACATTACCAATTTAATGACAGCGTTATGTTGATACTGTAACATTTTAAGCATACAGCAGGTAATGTTTACAGTAACTTTGATCGTTAC[A/T]GTGTTAACATGCCTCAGAAGCGGCGCACGCAGTCGTGGACGGATCTCAAACAAGCCGGTAACGAGTGCTTCAAAGCGGGTCAGTATGGAGAAGCGGTGACCCTCTACAGCCAGGCCATCCAGCAGCTGGAGAAATCTGGTAAGAGGTCTCAGATATTACATATATTGCTTGGGTGAATATCATCCTTACAGTATTACCTTTTAGATAAACATGTTTTTGTACATCTGATAGTACCATAGTATTCTAGCAGTAGCACCTAGACTTTTAATGTCTCATTGTATTTGTGTAACTGGCAGTATAATATAAACACCATGGTAAATTAATTTGAGTAGTGTATTATCTCAGAGGTTTCAAACTGGGGCCCAGGGACATTGATGTATAGATGGTTTTATATTGACACAATCTGACTTCCTCCGTTATAATATAATTTCAGAAAATTCATTCATTCATTTATTTTCTTCTCGGCTTAGTCCCTTCATTAATCCAGGGTCGCCACAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2296
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001803 Essential Splice Site 44 305 2 8

The following transcripts of ENSDARG00000001557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 52184998)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52234180
GRCz11 6 52234179
KASP Assay ID:
554-2697.1 (used for ordering genotyping assays)
KASP Sequence:
GAAGCGGTGACCCTCTACAGCCAKGCCATCCAGCAGCTGGAGAAATCTGG[T/C]AAGAGGTCTCAGATATTACATATATTGCTTGGGTGAATATCATCCTTACA
Long Flanking Sequence:
CTGAAATTTAATACCGCCCGTTTCATTAGACACACAGCCGGTAAAACGTGGTGCTCATCCCGACTAGCGTGTGTGTGAAAGGCGGAGAAGAGAATTTCTAGCATGTTCTAGGAGGAGGACGGACTGGTTATCTAGTATAGGTCTCTAGCTCGTTGTTAAATACAGTAACTGCTAACTTTAAACAGCCGATCACTAAAGCTCTTCCTTCAGCCTTTACTTTCCGGGTTTTTCCACCAACACGATTCTATAGGGTAACTTTTTGTTTCGTTTATACATTACCAATTTAATGACAGCGTTATGTTGATACTGTAACATTTTAAGCATACAGCAGGTAATGTTTACAGTAACTTTGATCGTTACAGTGTTAACATGCCTCAGAAGCGGCGCACGCAGTCGTGGACGGATCTCAAACAAGCCGGTAACGAGTGCTTCAAAGCGGGTCAGTATGGAGAAGCGGTGACCCTCTACAGCCAGGCCATCCAGCAGCTGGAGAAATCTGG[T/C]AAGAGGTCTCAGATATTACATATATTGCTTGGGTGAATATCATCCTTACAGTATTACCTTTTAGATAAACATGTTTTTGTACATCTGATAGTACCATAGTATTCTAGCAGTAGCACCTAGACTTTTAATGTCTCATTGTATTTGTGTAACTGGCAGTATAATATAAACACCATGGTAAATTAATTTGAGTAGTGTATTATCTCAGAGGTTTCAAACTGGGGCCCAGGGACATTGATGTATAGATGGTTTTATATTGACACAATCTGACTTCCTCCGTTATAATATAATTTCAGAAAATTCATTCATTCATTTATTTTCTTCTCGGCTTAGTCCCTTCATTAATCCAGGGTCGCCACAGCGGAATGAATCGCCAACTTATCCAGCACATTTTTACACAGCGGATTGCCTTCCAGCCGCAACCCATCTCTGGGAAACATCCATACACACTCAAAACACTCACTCACAATTTAGCCTACCCAGTTCACCTGTACCATATGTCT
Associated Phenotype:
Not determined