Busch Lab

ZMP

adam8a

Ensembl ID:
ENSDARG00000001452
ZFIN ID:
ZDB-GENE-030616-622
Description:
a disintegrin and metalloproteinase domain 8a [Source:RefSeq peptide;Acc:NP_956931]
Mouse Orthologue:
Adam8
Mouse Description:
a disintegrin and metallopeptidase domain 8 Gene [Source:MGI Symbol;Acc:MGI:107825]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22294 Nonsense Available for shipment Available now
sa12999 Essential Splice Site Available for shipment Available now
sa12984 Essential Splice Site Available for shipment Available now
sa42203 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22295 Essential Splice Site Available for shipment Available now
sa10470 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22294
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Nonsense 57 843 3 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24895772)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24541432
GRCz11 13 24671882
KASP Assay ID:
2260-6403.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCTTGCTTGCTTTGATTTATTTAGAAATATCCTGAGCAACTTGAATA[T/A]GATGTGGCTATAGATGGGAGAAACTTGACAATATCTTTGCACAGAAATAG
Long Flanking Sequence:
GGTCGTAAACTTCTATGCTAATTTACCGTATAACCGAGGCGGAGCTTTAACTTTCAAGTAGCCCGAGTTTGTTCCCACAGACAGCAGCAGCAGCCCTCGAGTCCCGGAGCGAGAGCACACACAGCACAGCGAGCCATGCGATACACTGGACTATTTATAACGCTGCTTTCTTTCGTTTATACATGGGGTGAGCGCACAGATATGTGAGGATTCTTTAACAGCGAGTCATGTCAGTTTGCGTGATGTGTTTTACATGTAATTTAATCCTGTGGTGGTGATTTGTTTGTTGCTGTAGAGAGTCTGGAGGCTTTACCTCATGTGATGCGCTATGATGTGGTCCGGCTTCAGGCATTGAGAGGGAGAACCAGAAGAAGCGCCTCTTCCCTCCAGGTCCTTACTTTAATAACTGACTTATTGACATTTACACTGGATGATTGAGTTACTTTTATTCATGCTTGCTTGCTTTGATTTATTTAGAAATATCCTGAGCAACTTGAATA[T/A]GATGTGGCTATAGATGGGAGAAACTTGACAATATCTTTGCACAGAAATAGGTGAGAATGGGACTGTCTATTGCAACAATGTATGTTAATACTATGTGGAGGCATTGCATTTATACTCGTCCTTTGTTTTATAGAGAACTTTTAGGGAAACAATACACTTTGACACATTATGGCGAAGATGGGATTTCCGAGACAAAGTCATCAAACAAATTTGTATGTGGAAATTTTCAACTAACATGTTAATTTGCTGTATGTTTGACACAGTGTGTGTATATGAAGCTTAATGCTATTGTCTTTTGTGTTCATATCAGAATCACTGCTACTATCATGGACACATCCATAATTTTGAAGATTCCTCAGTCAGCGTGGGACTTTGTTCTGGAATGGAGTAAGAAAAATTAAATATTAAGCAACTTTTGAAAAGAATAGATTGAACATCAAATATGTTGTAAAATATACATAAATATATATTAAATATTCTTGATGTCTACTTTGTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 126 843 5 25
ENSDART00000001678 Essential Splice Site 126 843 5 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24896161)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24541821
GRCz11 13 24672271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAWTTTGAAGATTCYTCAGTCAGCRTGGSACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATKAAATATTMAGCAACTTTTGAAAAGAATAGATTGAACATCA
Long Flanking Sequence:
GGTCCTTACTTTAATAACTGACTTATTGACATTTACACTGGATGATTGAGTTACTTTTATTCATGCTTGCTTGCTTTGATTTATTTAGAAATATCCTGAGCAACTTGAATATGATGTGGCTATAGATGGGAGAAACTTGACAATATCTTTGCACAGAAATAGGTGAGAATGGGACTGTCTATTGCAACAATGTATGTTAATACTATGTGGAGGCATTGCATTTATACTCGTCCTTTGTTTTATAGAGAACTTTTAGGGAAACAATACACTTTGACACATTATGGCGAAGATGGGATTTCCGAGACAAAGTCATCAAACAAATTTGTATGTGGAAATTTTCAACTAACATGTTAATTTGCTGTATGTTTGACACAGTGTGTGTATATGAAGCTTAATGCTATTGTCTTTTGTGTTCATATCAGAATCACTGCTACTATCATGGACACATCCATAATTTTGAAGATTCCTCAGTCAGCGTGGGACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATTAAATATTAAGCAACTTTTGAAAAGAATAGATTGAACATCAAATATGTTGTAAAATATACATAAATATATATTAAATATTCTTGATGTCTACTTTGTGTAGAGTAAAAACATTGATTCGCAGTTGCATTTCTTTGGAAAACATTGACAAATGCTTACAAAATTTCCACTAATATTTAATGCATGTATTCTTGTTGTTGTACAGAGGATTTCTGAGAGTGAACGATCAGGTTTATTTGATAGAGCCCTTGGAAGAGTCTTTGGATGGGGACCATGCTATTTACAAGCAAGAGCATTTAAGGACCAAGCGAGGGGCCTATGGATACATTAATGACACAGTCTATGACCTTGGCCCAAAGTCTAGTGGGCTGTATAAAGGAAAAAATATGGTAATGATTTTATAATAATCTGTTATTAAACCTAAGCTGTAATTATTTCAGTGATATTTTTAGCATTTTATATTTAACCATATATTTAGTGACGGTTTTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 126 843 5 25
ENSDART00000001678 Essential Splice Site 126 843 5 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24896161)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24541821
GRCz11 13 24672271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAAWTTTGAAGATTCYTCAGTCAGCRTGGSACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATKAAATATTMAGCAACTTTTGAAAAGAATAGATTGAACATCA
Long Flanking Sequence:
GGTCCTTACTTTAATAACTGACTTATTGACATTTACACTGGATGATTGAGTTACTTTTATTCATGCTTGCTTGCTTTGATTTATTTAGAAATATCCTGAGCAACTTGAATATGATGTGGCTATAGATGGGAGAAACTTGACAATATCTTTGCACAGAAATAGGTGAGAATGGGACTGTCTATTGCAACAATGTATGTTAATACTATGTGGAGGCATTGCATTTATACTCGTCCTTTGTTTTATAGAGAACTTTTAGGGAAACAATACACTTTGACACATTATGGCGAAGATGGGATTTCCGAGACAAAGTCATCAAACAAATTTGTATGTGGAAATTTTCAACTAACATGTTAATTTGCTGTATGTTTGACACAGTGTGTGTATATGAAGCTTAATGCTATTGTCTTTTGTGTTCATATCAGAATCACTGCTACTATCATGGACACATCCATAATTTTGAAGATTCCTCAGTCAGCGTGGGACTTTGTTCTGGAATGGAG[T/G]AAGAAAAATTAAATATTAAGCAACTTTTGAAAAGAATAGATTGAACATCAAATATGTTGTAAAATATACATAAATATATATTAAATATTCTTGATGTCTACTTTGTGTAGAGTAAAAACATTGATTCGCAGTTGCATTTCTTTGGAAAACATTGACAAATGCTTACAAAATTTCCACTAATATTTAATGCATGTATTCTTGTTGTTGTACAGAGGATTTCTGAGAGTGAACGATCAGGTTTATTTGATAGAGCCCTTGGAAGAGTCTTTGGATGGGGACCATGCTATTTACAAGCAAGAGCATTTAAGGACCAAGCGAGGGGCCTATGGATACATTAATGACACAGTCTATGACCTTGGCCCAAAGTCTAGTGGGCTGTATAAAGGAAAAAATATGGTAATGATTTTATAATAATCTGTTATTAAACCTAAGCTGTAATTATTTCAGTGATATTTTTAGCATTTTATATTTAACCATATATTTAGTGACGGTTTTCAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6299
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Splice Site, Nonsense 539 843 15 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24900033)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24545693
GRCz11 13 24676143
KASP Assay ID:
554-5261.1 (used for ordering genotyping assays)
KASP Sequence:
ATGACGCCTGCTTTCAGTATAATGTGATTGACAGAACCTCCAAAAGCGCT[G/T]AGTAAGTTCAACCTTCCNTTTTTTTTGATGGCTGAAGGCTAAAGACTTTT
Long Flanking Sequence:
CTGCCCATCAGACTCAATACCGAACACAATTTTGAACTTGTTCTGAACATGTGAAAGTAAATTACATCTCAGTTTGTCTCATTCATCCGCCATTCTAGCTGAAACATACAGGCAGCCTGTGCAGAAAAAGTGCTCACGACTGTGATTTGGACGAATACTGTACAGGAGAGTCAGCTTTCTGTCCTGAAGATGATTATAAGATGAATGGACTCCCCTGCAATTATAATCAGGGATACTGTTACAACGGACAATGTCCAACACACAAGGAACACTGCAAGATGCTGTGGGGATCAGGTACTCATTTCTCAAATACTGCATTATGGATCATTTACTACTACTGTTTTACTATTTCAGTGTTTAATAATCAGCGTTTTTTTATTAAATGAAGTTTCATACAAGTATTTTTGCTATAACCTGTAATATCCCTGTGCTTAGGTGCTGATGTGGATGATGACGCCTGCTTTCAGTATAATGTGATTGACAGAACCTCCAAAAGCGCT[G/T]AGTAAGTTCAACCTTCCTTTTTTTTTGATGGCTGAAGGCTAAAGACTTTTGTTTTCTAACAAGACTTTTTAAAAAAAACCTATAGACACCGAAAATGTGGGAGAATATACTGTTATGGTGGGAATCCTTTTCCAAAAACCAACAAAAAAGCAAATGTAAATGTTCAATCAAGAACCTGCTACATGGCTTTGGATTCATCACCCACAGAAGACTTAGGCATGGTTCCTACAGGCACCAAATGTGGCACAAATAAGGTCATTAAAGAATCAATGTGTAAAAATACCCAGTGGACAAAAGCTTTATTTATTCATTTATTTCCAATATATTTTTCAATCAACAGGTGTGTTACAAAAGCCTTTGCCTCGATATCAGTATGTACGGCACTGAGAACTGCTCGAATAAATGCAACAATCGTGGGGTATATGATTTAATTCTAACTTTTCGTTTTTATGTATATAAATTTTATTATTTATTTATTTTAAAGTGTATTTATCATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 595 843 None 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24900289)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24545949
GRCz11 13 24676399
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGACTTAGGCATGGTTCCTACAGGCACCAAATGTGGCACAAATAAGG[T/C]CATTAAAGAATCAATGTGTAAAAATACCCAGTGGACAAAAGCTTTATTTA
Long Flanking Sequence:
AACACACAAGGAACACTGCAAGATGCTGTGGGGATCAGGTACTCATTTCTCAAATACTGCATTATGGATCATTTACTACTACTGTTTTACTATTTCAGTGTTTAATAATCAGCGTTTTTTTATTAAATGAAGTTTCATACAAGTATTTTTGCTATAACCTGTAATATCCCTGTGCTTAGGTGCTGATGTGGATGATGACGCCTGCTTTCAGTATAATGTGATTGACAGAACCTCCAAAAGCGCTGAGTAAGTTCAACCTTCCTTTTTTTTTGATGGCTGAAGGCTAAAGACTTTTGTTTTCTAACAAGACTTTTTAAAAAAAACCTATAGACACCGAAAATGTGGGAGAATATACTGTTATGGTGGGAATCCTTTTCCAAAAACCAACAAAAAAGCAAATGTAAATGTTCAATCAAGAACCTGCTACATGGCTTTGGATTCATCACCCACAGAAGACTTAGGCATGGTTCCTACAGGCACCAAATGTGGCACAAATAAGG[T/C]CATTAAAGAATCAATGTGTAAAAATACCCAGTGGACAAAAGCTTTATTTATTCATTTATTTCCAATATATTTTTCAATCAACAGGTGTGTTACAAAAGCCTTTGCCTCGATATCAGTATGTACGGCACTGAGAACTGCTCGAATAAATGCAACAATCGTGGGGTATATGATTTAATTCTAACTTTTCGTTTTTATGTATATAAATTTTATTATTTATTTATTTTAAAGTGTATTTATCATTTTTAAAGTTATAATGTCCTGCTTGTCATAAATTCATTTTGTGTTCTATTAATAAGTCGTTTTAAAAACAGTATATTGTCTTGTCTGGAAAATATATTGTTGAATGCATAAACACATGTAACTTTATTGTCTACTTATATTTTAAAGGTGTGCAACCACGAGTTGAAGTGTCACTGCGATCCAGGCTGGGCACCACCCTATTGTGATATTCAACTCTCAGAACTTCACAAAAGTAAAACAATTACATTCCATTATATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22295
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Essential Splice Site 596 843 None 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24900372)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24546032
GRCz11 13 24676482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAAAAGCTTTATTTATTCATTTATTTCCAATATATTTTTCAATCAAC[A/G]GGTGTGTTACAAAAGCCTTTGCCTCGATATCAGTATGTACGGCACTGAGA
Long Flanking Sequence:
GTTTTACTATTTCAGTGTTTAATAATCAGCGTTTTTTTATTAAATGAAGTTTCATACAAGTATTTTTGCTATAACCTGTAATATCCCTGTGCTTAGGTGCTGATGTGGATGATGACGCCTGCTTTCAGTATAATGTGATTGACAGAACCTCCAAAAGCGCTGAGTAAGTTCAACCTTCCTTTTTTTTTGATGGCTGAAGGCTAAAGACTTTTGTTTTCTAACAAGACTTTTTAAAAAAAACCTATAGACACCGAAAATGTGGGAGAATATACTGTTATGGTGGGAATCCTTTTCCAAAAACCAACAAAAAAGCAAATGTAAATGTTCAATCAAGAACCTGCTACATGGCTTTGGATTCATCACCCACAGAAGACTTAGGCATGGTTCCTACAGGCACCAAATGTGGCACAAATAAGGTCATTAAAGAATCAATGTGTAAAAATACCCAGTGGACAAAAGCTTTATTTATTCATTTATTTCCAATATATTTTTCAATCAAC[A/G]GGTGTGTTACAAAAGCCTTTGCCTCGATATCAGTATGTACGGCACTGAGAACTGCTCGAATAAATGCAACAATCGTGGGGTATATGATTTAATTCTAACTTTTCGTTTTTATGTATATAAATTTTATTATTTATTTATTTTAAAGTGTATTTATCATTTTTAAAGTTATAATGTCCTGCTTGTCATAAATTCATTTTGTGTTCTATTAATAAGTCGTTTTAAAAACAGTATATTGTCTTGTCTGGAAAATATATTGTTGAATGCATAAACACATGTAACTTTATTGTCTACTTATATTTTAAAGGTGTGCAACCACGAGTTGAAGTGTCACTGCGATCCAGGCTGGGCACCACCCTATTGTGATATTCAACTCTCAGAACTTCACAAAAGTAAAACAATTACATTCCATTATATTCTGAATTACCTCAAGGTATTCAACCGAAAACTAATTCTATTTACTGTCAACTGTCTGATTTTCATCTTCAGTGAGAAAATCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10470
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001678 Nonsense 685 843 19 25

The following transcripts of ENSDARG00000001452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 24900963)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24546623
GRCz11 13 24677073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATTATTATTGGAGCGCTGGTGTATAACAGAAACAAAATAACAGAATTT[A/T]GAAAGAAAAGGTAAGACGTCTTATTGATTTCTGTGATCATTCATTTATGG
Long Flanking Sequence:
AATTCTAACTTTTCGTTTTTATGTATATAAATTTTATTATTTATTTATTTTAAAGTGTATTTATCATTTTTAAAGTTATAATGTCCTGCTTGTCATAAATTCATTTTGTGTTCTATTAATAAGTCGTTTTAAAAACAGTATATTGTCTTGTCTGGAAAATATATTGTTGAATGCATAAACACATGTAACTTTATTGTCTACTTATATTTTAAAGGTGTGCAACCACGAGTTGAAGTGTCACTGCGATCCAGGCTGGGCACCACCCTATTGTGATATTCAACTCTCAGAACTTCACAAAAGTAAAACAATTACATTCCATTATATTCTGAATTACCTCAAGGTATTCAACCGAAAACTAATTCTATTTACTGTCAACTGTCTGATTTTCATCTTCAGTGAGAAAATCTGTGGTTATTGGTGTTACTACATCTTTAGCCATCCTTGTGCTGATCATTATTATTGGAGCGCTGGTGTATAACAGAAACAAAATAACAGAATTT[A/T]GAAAGAAAAGGTAAGACGTCTTATTGATTTCTGTGATCATTCATTTATGGTTGTATGCATTACAATTGTTTTGAGATTAAAGTAGCACTTTCTTTTTCTAAAAGGCCACAGAAGGGCATCCACTCTTCTTCAGGCCAATGCAATCCTGCATTTCAACCAGGAAGCGCAAAGAACAGCCCCAGAATTGCACAGCCACGTATCAGTCAACCAACTTTCCTTGAGTCGTCTGCTACTCAGGCCTGTAAACCTCTTCGGTCTGCGGCTATGCCCTGTAGACCAGCACCAATGGTAAAATTTAGGCTTGAAATGAGCTGCTTAATTTTATATTTTGTATTGAATGTTATTTTTAGAATAAATGATGAAGGAAATTACTGAATATAAATCTAAATACCACTTTTTTTTGCATTACGCACAGCCTCCAAAGAATGCACCACAGACCAGAAATGAACAGGTAGTTCATCTTCTGCAACAATTAAGCATTTGTATTTGATTCTATTCCT
Associated Phenotype:
Not determined