Busch Lab

ZMP

actn3b

Ensembl ID:
ENSDARG00000001431
ZFIN ID:
ZDB-GENE-030131-2040
Description:
actinin alpha 3b [Source:RefSeq peptide;Acc:NP_991107]
Mouse Orthologue:
Actn3
Mouse Description:
actinin alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99678]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20858 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20858
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 8 898 1 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 7866570)
Other Location(s):
Assembly Chromosome Position
GRCz11 7 6969930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAGGGTTAGAGGGATAGGTGTGAAAAGATGACGGCTGTTGTCGAGACG[C/T]AAATGCAGTATAACAACACCTACATGATGTCTACTACGCAAGACTACATG
Long Flanking Sequence:
GTTAACAGGCCTGGGATCTGCTCGTGCATCTATTTTCAGTCCAGAGCAGTAATTTGTATGTCGTTTAAACTGTCCCAAGAACTGCTGCTTGGGTAAATAGACATAAACTACTGCCAAGGACAACAGGTGTTCTTATAAAGCGGAGGGCACCAGTAGGCGTGTGTGTGAGGTCTTTCCCTGCCCTTCACTAAAAAGCCTCCAGTAATTGGTCCCAGTGCACAGTGTGTCCCGCCTCTCACACCTTTTGGGCAGCACAACCCGACACCCCCATGACTAGTACTCTTATTTATTGGGGTGCAGTCACGTGTGCTACTTTTGACCAGGATAGGAGCACTGGGCAGCAGAAGTTCTGCTCGCACCTCCACACCGGCACCTCAGACGAGTGGAGTCTGGCCTCTTCCTCCGCGGTCAACAGGATTTAGAGCTCTAAAGCGCACATTACTTCTAATAATAAGGGTTAGAGGGATAGGTGTGAAAAGATGACGGCTGTTGTCGAGACG[C/T]AAATGCAGTATAACAACACCTACATGATGTCTACTACGCAAGACTACATGATTCAGGAGGATGATTGGGACAGGGACCTGCTGCTGGACCCTGCCTGGGAGAAACAGCAGAGGAAGGTATGTTTATCAATGTATTGAATATCTTTAAGGGGTTACATGTTATGATGATGTGCATGTATATTTACCATTTCCAATCAACAGTGATTAATTCTATAAGGTTATTATTTCTAAAAGGTATTGTTCATTTTATATGACCTTTTTCACTATGTTTTTGTGTAAATTGAACAATTATTTTACATATATTGAAACCATGCTGCATATATTTACCAGTCCCGCCTGGATTTTGCAGGGACAGCAAGTTTTTGTTGTATATATATTCTTTAAATGTATATATGTTATTACCTAATATATTAATAAGTGTTAATGTTAATATAAATATATACTAATATATATTACCTAAAATGACTGATTTTGTGATGGGTTTCTCAAAACTTACTGCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8257
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 264 898 8 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 7920757)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6864850
GRCz11 7 7098229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCCATCATGACCTACGTGTCCTGCTTTTACCATGCTTTCGCTGGTGCT[G/T]AACAGGTAAAAATGAYYACRNNNNNNNNTTATTCWGAATTCAGTTTCACA
Long Flanking Sequence:
ATATCCGCGGCGCCCCAACCCCCCGCCCCCCACTTTCACATTAGGGTTGAGGGCAGCGTTACCGTCCTTTGCCTAGAGCGGCAGTTCAGCTTGCTCCGGCCATGACTTTACATCTTACAAAATAATAGGCGGCATAATAGGTCCCCTTTACATCTTAATGTAATCAACTTACTTTGAACAGCAATTGATTTTCAGTAGTGCAGAATCACTCCCCCTGCCTCATTTAATTTTTTTAATGTGTTATTGACGTTATTCTTTTAATTTAGGCCTTTCTTCAGTGTTTTAATTTGTCATTTTGTTTTATTGTTGACAAAAGCACTTTGGGCGGCCCCTTCGGTTGTAGTAAGATAAGATACAAAGTACAAAGACACTATGTATAAAACATTATAATTATAGTGCTGATTTTGATTTGATCCTCAGACATTGTCAACACTCCTAAACCTGACGAGAAAGCCATCATGACCTACGTGTCCTGCTTTTACCATGCTTTCGCTGGTGCT[G/T]AACAGGTAAAAATGATCACGCATCACATTTATTCTGAATTCAGTTTCACAAAATACAATGTAAAGTAATTACTTTCAAAACACTTTGAAGCTGTAAATGAAGTGTGGAGACTCTAATACAGACACATCAACTCTAAACTGAACTGGTTATTGCAGTAAATGAGCTTGTTATCTCCATTTCTCTAGGCTGAGACGGCTGCTAACAGGATCTGCAAGGTTCTAGCTGTGAACCAGGAGAATGAACGGCTGATGGAGGAGTATGAGAAACTGGCCAGCGAGGTGAGAAGATCTGCCTCTTTAATCTCTGATAAACATCCAGTACAGATGATTTTGGATCATTGCATGGCGTAAGATGAGCGATCAACGGGTTTATGGTTTTACATCAGGTTTTGTTCATTGAGATCATCCTTTTTTTAAGAAATGTAAGAAAATGACTAACTGATACCAAAAAATAACAAAGGAGATACAGATAAAGACAAACTTATTATCAGTCCTTTGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2392
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001649 Nonsense 574 898 15 21

The following transcripts of ENSDARG00000001431 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 7947659)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6881793
GRCz11 7 7115172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCTGATCACAGCTCACGACCAGTTTAAAGCCACTCTTCCCGAGGCYGAT[A/T]AGGAGCGAATGGCCGTGATGGGCAYCCAGAACGAGATCGTGAAGATYGCT
Long Flanking Sequence:
CTGAAGACCTGTAACCACTGCCTTCCATAGAGGCAAAACAATGGAAGCCAATGGTTACTGGTTTCCAACATTTTTCAGAATATCTTGTTTTGAGTTCAACAGAAGAAAGAAACTCAACTAAAGGCTGAGTAAATGATGACAGGATTTTTATTTTTGGGTGAGCCGTTTTTTCAAGTTTATCTATAAACTAATGTGCTTCAAAACTGTGTCAGCATTTAAATTAAGAAGATATAAACATACCGGTGCTATCTGAAATAGAAAGCTGTATTTTAAAGTGCAGAAACAGTCAGTCACACAGACTATTACTACTATTAGTATTATTGTGGACTTGATTCTGATGACTCTGTGATGTAAAGGGAATGCTATTGGCTGTTTTAAAAGGGGGGAGGGGCTACTCTATGATAGTTTTTTTTTTTTGTTAATTGTTCGAATCTCCATTTGTCCATCAGAGTCTGATCACAGCTCACGACCAGTTTAAAGCCACTCTTCCCGAGGCTGAT[A/T]AGGAGCGAATGGCCGTGATGGGCATCCAGAACGAGATCGTGAAGATTGCTCAGACCTACGGCATCAAGCTGGTCGGAGTCAATCCATACTCAGTGCTCAGCCCACAGGACATCACCAACAAATGGGAGGCTGTGAGTACAGAGTAAACACACTCACACACACACTAAAAAAACTAAATAATAACACTGTTGTATTCTACAGAGCTGTTTTTAGCCAAATCAGACTTGTAACTTTTAGTGATTGCACCAATTGGAAAATTTTACGCAATACCAATAACTGATATATTTAGAAACCGATATCCAATATATACAGTCAGAATTATTTGCCTCCCTGAATTTTGTTTCCCCCAATTTCTGTGTAACAGAAAGAAGATTTTTTTTTTCTCATCACATTTCTAAGCATATTAGTTTTAAAAACTCATTTCTAATAACAGATTTCTCTTATCTTTGCCACGATGACAGCACTTAATATTTGACTAGATATTCTTCAAGATACTAGTA
Associated Phenotype:
Not determined