Busch Lab

ZMP

slc6a13l

Ensembl ID:
ENSDARG00000001354
ZFIN ID:
ZDB-GENE-030616-628
Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 like [Source:RefSeq peptide
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa33929 Nonsense Mutation detected in F1 DNA Not yet available
sa10303 Nonsense Available for shipment Available now
sa20785 Nonsense Available for shipment Available now
sa11020 Nonsense Available for shipment Available now
sa18849 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 301 608 7 14
ENSDART00000143577 Nonsense 287 543 7 13
Genomic Location (Zv9):
Chromosome 6 (position 41085563)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41157163
GRCz11 6 41154699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGGAGTTTGTACAGGAGTACTGACTGCACTGGGAAGCTACAACAAATA[T/A]GACAACAACTGCTACAGGTACTTTAGATGATCTTATATCACACTCTTTAC
Long Flanking Sequence:
CAAATCTTACACTCAACAGTGCCACTTTTGCATTTTGTGAAGCAAATTTGACGTAATTCATAAAAAAATGGAAAAATTATTAAAAATTAAATTTGAAATAATTGAAATTTCCCAATGTAAAAATTACTTGTAGGATTTTCAGCACAAGTAAAGTGTGACAGAAACTCTCTCTCTCTCTGTCTCTTTTTACAGGTGGTGTACTTCACAGCTACCTTCCCTTATTTAATGTTGATAGTATTGCTGGTTCGTGGACTTACTCTTCCTGGAGCAATAAATGGCATCACCTTCTACCTCTATCCTGATCCATCACGTCTCAAAGACCCACAGGCACTGAGCTGCTCTCTTTTGTTCAGTGAACACATTACATGTGAAATATTAAAAGCCAATGGTGATTTTTAAATATTAATGTTTCAGGTGTGGATGGATGCAGGAAGCCAGATATTTTACTCCTATGGAGTTTGTACAGGAGTACTGACTGCACTGGGAAGCTACAACAAATA[T/A]GACAACAACTGCTACAGGTACTTTAGATGATCTTATATCACACTCTTTACAGCAATTGTAGTCACATGAGTCTATTTTCATGGCAAATTAAGGTAATACAAATAATGCATCTTCTTATATGTATCTTTCAGGGACTGTGTATACCTGTGTCTGCTCAACAGCTTGACTAGCTTTGTGGCTGGTTTTGCTATATTTTCAGTCCTTGGCTTTATGGCAGATGAACAGGGGGTGGATATTTCGTTGGTGGCAGAGTCAGGTAAAAGGCTAATTTATGGCTTGATGTCTTGTAACTCTTTCCACGCCACACTTTATATGAAAGTTGCAGCCTCCCTTATTTTTTAGTCGGTGATTTTCACCTAAATTTGAATTCCTCAAAATATGTTTTGATATGAATAGTCTTTGATATTAATTCATTAAGTTTCCTTCTGCTTAGTCCTTTAATAATCAGGGGTCACCACGGCTAAATGAACTGACAACGATTACAGCATGTTTTATGCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26800
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Essential Splice Site 349 608 9 14
ENSDART00000143577 Essential Splice Site 335 543 9 13
Genomic Location (Zv9):
Chromosome 6 (position 41087364)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41158964
GRCz11 6 41156500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGC[A/G]GGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCC
Long Flanking Sequence:
TTATAAAGTTATAATGAAGCAGAATTGTTGCAATGTGTTAAAATGTATGAACACTACACTTAAATTACCCCATAATTAAACCACTTACACAGATAGTACTGATTCAATATAGTCAGCATAGCATTTACTTTTACTTGTGTTCTTTCTGAAAGTCCTGCATTGAACTGTGCCTTGTTTCTTAACAAATCGGCATAAAAAGTGGGCGTTGATCTACTGCTGTGGAGGCGGAGTTTGGCCTCACTATGACATGATAAAGTGGCTCATTCGCCAGCTTGTAATTTTTTGGCAGATTCGCTTACACTGTTTTTAGACTAACTAGAAAGCTTTGAGTTATGAAATTCACAGGATGTTTTTTAACATCACAATGACCTTTTTTAGTACCTGACCTCTTTATAATTAAAAAATAGGGCTCTTTGAAATCACAGGGATAGGCAATGCAATGATCATGTTGTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGC[A/G]GGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCCTTTGCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10303
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 366 608 9 14
ENSDART00000143577 Nonsense 352 543 9 13
Genomic Location (Zv9):
Chromosome 6 (position 41087417)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159017
GRCz11 6 41156553
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
KCCTGGTTTGGCGTTCATYGCTTACCCCCGTGCTGTAGCTYTGATGCCTT[T/A]GCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGAC
Long Flanking Sequence:
CTACACTTAAATTACCCCATAATTAAACCACTTACACAGATAGTACTGATTCAATATAGTCAGCATAGCATTTACTTTTACTTGTGTTCTTTCTGAAAGTCCTGCATTGAACTGTGCCTTGTTTCTTAACAAATCGGCATAAAAAGTGGGCGTTGATCTACTGCTGTGGAGGCGGAGTTTGGCCTCACTATGACATGATAAAGTGGCTCATTCGCCAGCTTGTAATTTTTTGGCAGATTCGCTTACACTGTTTTTAGACTAACTAGAAAGCTTTGAGTTATGAAATTCACAGGATGTTTTTTAACATCACAATGACCTTTTTTAGTACCTGACCTCTTTATAATTAAAAAATAGGGCTCTTTGAAATCACAGGGATAGGCAATGCAATGATCATGTTGTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGCAGGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCCTT[T/A]GCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTATGGTAAATAATTTTGTTGATTCTACAAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20785
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 389 608 10 14
ENSDART00000143577 Nonsense 375 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087574)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159174
GRCz11 6 41156710
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTA[T/A]CAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCA
Long Flanking Sequence:
CTACTGCTGTGGAGGCGGAGTTTGGCCTCACTATGACATGATAAAGTGGCTCATTCGCCAGCTTGTAATTTTTTGGCAGATTCGCTTACACTGTTTTTAGACTAACTAGAAAGCTTTGAGTTATGAAATTCACAGGATGTTTTTTAACATCACAATGACCTTTTTTAGTACCTGACCTCTTTATAATTAAAAAATAGGGCTCTTTGAAATCACAGGGATAGGCAATGCAATGATCATGTTGTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGCAGGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCCTTTGCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTA[T/A]CAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTATGGTAAATAATTTTGTTGATTCTACAAAGACAAAAAATAGTGAACAGTGAGTGTACATGAAATGGAAACCCCAAGTGGTACTCACTGCAGAGCCACTTGGGCAGAGCTGAGCTCCATCAAGGGAGAGCCTTGCTTCACTTCTTCTACAAGTGATGTCACTGGGGGTTAGGGGCGGGGTAGGTGTGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11020
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087610)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159210
GRCz11 6 41156746
KASP Assay ID:
2259-7957.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTYTTCCAAGTTGGACATCGGCGYAAATTTCTTCTCCTCTTCAT
Long Flanking Sequence:
CATGATAAAGTGGCTCATTCGCCAGCTTGTAATTTTTTGGCAGATTCGCTTACACTGTTTTTAGACTAACTAGAAAGCTTTGAGTTATGAAATTCACAGGATGTTTTTTAACATCACAATGACCTTTTTTAGTACCTGACCTCTTTATAATTAAAAAATAGGGCTCTTTGAAATCACAGGGATAGGCAATGCAATGATCATGTTGTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGCAGGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCCTTTGCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTATGGTAAATAATTTTGTTGATTCTACAAAGACAAAAAATAGTGAACAGTGAGTGTACATGAAATGGAAACCCCAAGTGGTACTCACTGCAGAGCCACTTGGGCAGAGCTGAGCTCCATCAAGGGAGAGCCTTGCTTCACTTCTTCTACAAGTGATGTCACTGGGGGTTAGGGGCGGGGTAGGTGTGCGCAGTAGAAGGAGATGAAGATGAGCTCCCCCCAAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
ENSDART00000000838 Nonsense 401 608 10 14
ENSDART00000143577 Nonsense 387 543 10 13
Genomic Location (Zv9):
Chromosome 6 (position 41087610)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159210
GRCz11 6 41156746
KASP Assay ID:
2259-7957.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCAT
Long Flanking Sequence:
CATGATAAAGTGGCTCATTCGCCAGCTTGTAATTTTTTGGCAGATTCGCTTACACTGTTTTTAGACTAACTAGAAAGCTTTGAGTTATGAAATTCACAGGATGTTTTTTAACATCACAATGACCTTTTTTAGTACCTGACCTCTTTATAATTAAAAAATAGGGCTCTTTGAAATCACAGGGATAGGCAATGCAATGATCATGTTGTGTAAGAAGAAAATTCTTTGGTGATTTTTTTTTTTTTTTTTTTTGTGGCAGGTCCTGGTTTGGCGTTCATCGCTTACCCCCGTGCTGTAGCTCTGATGCCTTTGCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTA[T/A]CCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTATGGTAAATAATTTTGTTGATTCTACAAAGACAAAAAATAGTGAACAGTGAGTGTACATGAAATGGAAACCCCAAGTGGTACTCACTGCAGAGCCACTTGGGCAGAGCTGAGCTCCATCAAGGGAGAGCCTTGCTTCACTTCTTCTACAAGTGATGTCACTGGGGGTTAGGGGCGGGGTAGGTGTGCGCAGTAGAAGGAGATGAAGATGAGCTCCCCCCAAGTGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26801
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Splice Site, Nonsense 466 608 11 14
ENSDART00000143577 Splice Site, Nonsense 452 543 11 13
Genomic Location (Zv9):
Chromosome 6 (position 41087886)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41159486
GRCz11 6 41157022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTA[T/A]GGTAAATAATTTTGTTGATTCTACAAAGACAAAAAATAGTGAACAGTGAG
Long Flanking Sequence:
GCTTACCCCCGTGCTGTAGCTCTGATGCCTTTGCCTCAGCTATGGGCGATTTTCTTCTTTATCATGATCATATTTCTGGGACTGGATAGTGAGGTGAAAACTAAAAGAAATACTGATCTCTATTATATCTGCTACATCATAATATGGATCCTCTGAAGCATTTTCTTGTTATTGTTTCAGTTTGTGTATCAGGAAGCCCTGGTTACGTCTATCTCAGATATGTATCCCTCATTCTTCCAAGTTGGACATCGGCGCAAATTTCTTCTCCTCTTCATTTGTTCTGCCAGCTTTTTTGTTGGTCTGCTGATGGTAACAGAGGTAAGAATAGCAAATAAAAGCTAAATGTACATACAGTGCCTGTAATATTTTTAAACGTCTCGTCTTTTCTTTCTTTCTCAGGGTGGTCTGTATGTCTTCCAGCTTTTCGACTATTATGCCTGTAGTGGAATGACTCTTCTCACTTTTGCCATCCTTCAGTCCATCTGTGTTGGATGGGTTTA[T/A]GGTAAATAATTTTGTTGATTCTACAAAGACAAAAAATAGTGAACAGTGAGTGTACATGAAATGGAAACCCCAAGTGGTACTCACTGCAGAGCCACTTGGGCAGAGCTGAGCTCCATCAAGGGAGAGCCTTGCTTCACTTCTTCTACAAGTGATGTCACTGGGGGTTAGGGGCGGGGTAGGTGTGCGCAGTAGAAGGAGATGAAGATGAGCTCCCCCCAAGTGACTCGGCAGTGAGCATGCATTTGCAACTCTGGTGACCTCTGGTGAAACATTAGGAGAACTTCAGCTTAATAGTATTAGATCGAAGATTCACGCGCAGTATTGGCAAAATTCTTTAGCTTTTAAATATTTGCTCAGTTATTTTATGACATTTAGTACAGGTTTAATGAAAACGAGGACTATTTTCAGGACAATTAGGTAAAATAATACAAATGTACATTCTATTCCAGTTAAAGTAATTTTTTTTATTTTTTAAATAATGGTTTAGTTTGTGGTTATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26802
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000838 Nonsense 489 608 12 14
ENSDART00000143577 Nonsense 475 543 12 13
Genomic Location (Zv9):
Chromosome 6 (position 41088904)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41160504
GRCz11 6 41158040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGCGTTGAGGATATGATTGGATATCGGCCATGGCCCTTTATGAAGTG[C/A]TGCTGGAAATATCTAACGCCAGCTATATGCACAGTGAGTACCATTATAAA
Long Flanking Sequence:
TATACTGTATAAATTAGTTGATTTGGTGCATTTAGTAAAAGTTTTTAGGGTTACTAAAAGTGTTGTATAGTAAAGGTTCCAGAGCCTTTATTTATTAAAAAAGTGTTTTGTTTATTTTCAATTTTTTATTTTAAATGGTTTGAATTAGATTTCATGCTTATCATAAATATTTGAGTAATTGATTTTTCGTTACATTTTATTTTAATCTAAATTGATTAATTTCTTGGTAAAAAATAAAATATACGATGCACATATTTTTTATTTAATGTTTAATTTATTTTATGAAAAATGAATATAGTTTTATGACTTTACTTTAATTAAATATGTTAACCCTGGTCAATGATTGTATTCTTAGAAAATTAAAGGTGCTCAAATAGATTACACTGCACTTTACAAGTTTTACAATATTTTTTTTGTTTTTTTGTTTGCCCAGGAGCTGACCGTCACTATGATTGCGTTGAGGATATGATTGGATATCGGCCATGGCCCTTTATGAAGTG[C/A]TGCTGGAAATATCTAACGCCAGCTATATGCACAGTGAGTACCATTATAAAAGATTTTTTAAGACAAGAGGCTGCAAGCAAAAATGTAAGGCTTTCTGTCTTTTCATGATGTTTTTATTGAGTCTCATTTAAAGAAAACACCCCAAATCCACATTTATCTATTTTTGTCTGTAGATTTCAATTACATAACACAATAAAAATATACAGTTGAAGTAAGAATAAGTAGCCCCCCTTAGATTTTTTTTCTTTTTTAAATATTTCCCAAATTATGTTTACAGAGCAAGGAAATGTTCACAGTATGTCGGATAATATTTTTTCTTTTGGAGAAAGTCTTATTTGATTTATTTCAGCTAGAATAAAAGCATTTTTCAATTTTTAAGCACCATTTTTAGGTCAAATTTATTAGCCCCTTTAAGGTATATATTTTTACAATAGTCTACAGAACAAACCATCATTATACAATAACTTGCCTAATAACCCTAACCTGACTAGTTAACCTAA
Associated Phenotype:
Not determined