Busch Lab

ZMP

map4k2l

Ensembl ID:
ENSDARG00000001234
ZFIN ID:
ZDB-GENE-030616-163
Description:
mitogen-activated protein kinase kinase kinase kinase 2-like [Source:RefSeq peptide;Acc:NP_00103544
Human Orthologue:
MAP4K2
Human Description:
mitogen-activated protein kinase kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6864]
Mouse Orthologue:
Map4k2
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346883]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa26915 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26915
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009367 Nonsense 352 865 15 32
Genomic Location (Zv9):
Chromosome 7 (position 18844395)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17411917
GRCz11 7 17663890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAAATTTCACAGGAGGGCTAATAACTGTATATGTCCGTCATTAGGGAT[C/A]ATGTGATGATTGGAGCATATCTGGAGATGAACCCGAGTCACCGTAAGTGC
Associated Phenotype:
Not determined