Busch Lab

ZMP

slc17a6a

Ensembl ID:
ENSDARG00000001127
ZFIN ID:
ZDB-GENE-050105-4
Description:
Vesicular glutamate transporter 2.2 [Source:UniProtKB/Swiss-Prot;Acc:Q5W8I7]
Human Orthologue:
SLC17A6
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 [Source:HGNC
Mouse Orthologue:
Slc17a6
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 Gene [Source

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa1530 Nonsense F2 line generated Not yet available
sa38140 Nonsense Mutation detected in F1 DNA Not yet available
sa9610 Nonsense Available for shipment Available now
sa44350 Nonsense Mutation detected in F1 DNA Not yet available
sa16943 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1530
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Nonsense 7 587 1 12
Genomic Location (Zv9):
Chromosome 25 (position 36312600)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34746340
GRCz11 25 35251298
KASP Assay ID:
554-1454.1 (used for ordering genotyping assays)
KASP Sequence:
TATTAATATCGAGTGGATTATTATCTCTGGCGATGGATACAGTGAAGGAG[C/T]GAGTTTTGGCACCCGGCAAGGAGAAAATGAAGAATCTGGCCGGGAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38140
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Nonsense 25 587 1 12
Genomic Location (Zv9):
Chromosome 25 (position 36312654)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34746394
GRCz11 25 35251352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGGCACCCGGCAAGGAGAAAATGAAGAATCTGGCCGGGAAAACCCTC[G/T]GACACATGCACAGGTATACCCTTCACATATAAAAAAATATTACTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Nonsense 212 587 5 12
Genomic Location (Zv9):
Chromosome 25 (position 36322040)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34755780
GRCz11 25 35260738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATACCCAGCMTGCCATGGGATTTGGAGCAAGTGGGCTCCACCACTTGAG[A/T]GAAGTCGTTTAGCAACCACCTCTTTTTGTGGTAAATACAATTTGCATTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4331
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Essential Splice Site 251 587 6 12
Genomic Location (Zv9):
Chromosome 25 (position 36322241)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34755981
GRCz11 25 35260939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAATATTAGTGCAGTACTCAGGCTGGTCTTCCGTCTTCTACATTTATGG[T/A]AKGTGCATAATCTTGACTGTAATCTTCTGTAATGCTTGCTTTNNNNTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44350
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Nonsense 257 587 7 12
Genomic Location (Zv9):
Chromosome 25 (position 36322345)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34756085
GRCz11 25 35261043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCACGATTTTCTCTCTATTTGGGCTTCAGGGAGTTTTGGGATCGTCTG[G/A]TACATGTTTTGGATTCTGGTTTCATACGAGAGCCCGGCGGATCATCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003494 Essential Splice Site 392 587 9 12
Genomic Location (Zv9):
Chromosome 25 (position 36327940)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34761680
GRCz11 25 35266638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAAACATCTTAACCACCACCACCGTCAGGAAAATCATGAACTGTGGAG[G/A]TGAGATCTGAGTTGTGCMYGATTCATCACTGAAAATGCAGTCTATTAGAC
Associated Phenotype:
Not determined