Busch Lab

ZMP

si:ch211-150d5.2

Ensembl ID:
ENSDARG00000001014
ZFIN IDs:
ZDB-GENE-030131-998, ZDB-GENE-091112-18
Human Orthologue:
MYH9
Human Description:
myosin, heavy chain 9, non-muscle [Source:HGNC Symbol;Acc:7579]
Mouse Orthologue:
Myh9
Mouse Description:
myosin, heavy polypeptide 9, non-muscle Gene [Source:MGI Symbol;Acc:MGI:107717]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa18627 Essential Splice Site, Missense Available for shipment Available now
sa39978 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33082 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25982
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Essential Splice Site 621 1686 15 36
ENSDART00000137105 Essential Splice Site 609 738 13 16
Genomic Location (Zv9):
Chromosome 3 (position 5757434)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5249405
GRCz11 3 5159246
KASP Assay ID:
2259-2989.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACTCAACCAGTCCACGGATAGATTTGTGTCTGAGCTGTGGAAAGACGG[T/A]GAGTTTCAGCTTCATGATCAACATTACAGCAGCAGATGTAGATGTGACCG
Long Flanking Sequence:
GGGCTTTCCCCCTCTAATGACACATAGAAAGTGCAAATGTCAATCAAAGTGTTTCTGCAGTTCTGTTTTTGTCAAGTCTGATTATAAGAAATAGAATTAATTATTTTTTACTATTAGAGGCTGGATATATTCACACACTGTGGCTGTGCTCTTTAAAGCTAAATTCATTCAGATGCCTTCAGCATTTCTCATATTATCCCTCTATATCCACCATTGTTTAGTAAATGGTACTAAAATATAAGCAGAAACGGAACAAATGAATCTTGATAATGTCCTGGACTAGTAAAAACAATGTCTAAATGGATATCTGGATTCTAAATGCACTAATAGTTAGACTGCATATGTCATTTGACACTTGTAAACGTGTGTATCTGTGTTTGTCAGGTGGACTATAAGGCAGACGAGTGGCTGATGAAGAACATGGACCCGCTGAATGATAACGTGGCCACTTTACTCAACCAGTCCACGGATAGATTTGTGTCTGAGCTGTGGAAAGACGG[T/A]GAGTTTCAGCTTCATGATCAACATTACAGCAGCAGATGTAGATGTGACCGTAGGGCTGGACGATTCACTGAAAGCCTAATTTACAACCTCTAACTCATCGAAAGTCAATCATTTTCAGTTGTTATTATGTACTTTTTTTCATTATAGACATTTGAAACACCCTTTTAAAGCACATGCGAGTTATTATTTTCAACTTTTTTCACATAGCAATTATCGTCAGCGTTTTTTCAAGTGTTGGTTATTTTTGACTTATATTTCGGCTAGTTATTGTCTTAATTTTAGTGTATTTTACGATAAACCAGATTTTTATTTTTCACAAGACATCTTCATTTCGAGCAGTCCGTGCTTTGGTTATATATATATATAAAGTTGGTTTTATATATATATATATATATATATATATATATATATATATATAAAGATGTATTATAATAAAATATACTGGGCAGCACGGTGGTGCAGTGGACAGAACATTCGCCTCACAGCAAGAAGGTCGCTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2138
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Nonsense 657 1686 16 36
ENSDART00000137105 Nonsense 645 738 14 16
Genomic Location (Zv9):
Chromosome 3 (position 5750821)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5242792
GRCz11 3 5152633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAGACYCGYAAGGGAATGTTCCGGACGGTCGGGCAGCTTTATAAAGAG[C/T]AGCTCTCCAAACTCATGGCCACGCTCAGAAACACCAACCCAAACTTTGTC
Long Flanking Sequence:
GCGCATTGAGCCTCATTTATGAAGCACAAGCAGAATGAATCACTCGTTAATGATATGAGATCTGTCATTCAGTTCAGCTTGTGTTTTCATGAGGAAGGTGTTTATTTTGGACCTCACACACACATATTACACACATGATCACACACACGTCCGTCTCACCTGCACTGCATTGAGTTGGATCATCTCCCCGTGTGTGTTTTCTCCTCCACTCTTCACCAGCATCATATGTGTGTGTGTGTGTGTGTCTGTGATTTGTCACTAGTGCTGAATTGTGTTTGCCCCACTGAATTGTGGGAAGCGTTCGCCTCATGACCAGACTGCATGCGCACTGAGATCAAGTGTCTACATCACAGTAACTGTACATGTGTGTTTGTGTGTGTGTGTGCGTCTCAGTGGACCGCATCGTGGGTCTGGATAAAGTTGCTGGGATGTCGGAGCTGCCGGGAGCCTTTAAGACTCGTAAGGGAATGTTCCGGACGGTCGGGCAGCTTTATAAAGAG[C/T]AGCTCTCCAAACTCATGGCCACGCTCAGAAACACCAACCCAAACTTTGTCCGCTGCATCATTCCCAACCACGAGAAGAAGGTACAGACATGTCCTCGGCATTACTACAGTTATTATTACAGTAAAAACATACACACCGCTAAAACAAGCTGTGAGATACTAACTTTCACTTTAACACTGTAACCAACTACAATCATTCTGACCGCTTCTCATATAAGACGACGTATTGTCACGTCATATTTACATTCGAAGCTTCTACTGAGATATTAAAATTAAGCTTTGAATGTTTGTCATCATATTTAATAAAGTCATCGCCATAAAAATATGATCTTTTTGGTAATGCAGCCTATAACTGTGAGGTTGGGCTACATTAGACCACACACATGGATGTCTGCGACTCTTTAATTTTTCATTGCGGCACTCTACATATGCTAAATGACACCTCTAAAATTACGTTTTTGCCATTTTGCCAATAGAAAGTTGTGGTATTTCATAATAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18627
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Essential Splice Site 747 1686 None 36
ENSDART00000137105 Missense 736 738 16 16
Genomic Location (Zv9):
Chromosome 3 (position 5747958)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5239929
GRCz11 3 5149770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCATTCCCAAAGGATTCATGGATGGCAAACAGGCCTGTATGCTGATGG[T/G]GAGAGMAGTTTTATGTTTAAACAATRTAAATAAAATCATTAGATGTCMTT
Long Flanking Sequence:
ATTATGATAAATATGTTATTAGCTCTTATTTACATATTTCCCACATGATGTTGAACAGATTCAGGAAATTATCACAGTATTTCCTCTAATATTTTTGTCTTCTGGAGAAAGTCTTGTTTGTTCTATTTCGGCTAGAATAAAAGCAGTTAAAAATATTTTTAAACCCATTTTTAAGTCAATATTATTAGCCACATTAAGCAATATTTATAATTATATATAACAATGACTTGCCTAATTACCTTAATTAACCCTAATTAACCTAGTTAAGCCTTTAAATATCACTTTAAGCTGAATACTAGTGTCTTGAAGAATATCGAGTCAAATATTATGTGCTGTCATCGTGGCAAATATACAGGAGTGCTAATAATTCTGACTTCAACTGGATATGGACGTTGTAATGTTTAATGGTGGTTTGTGTTTTTTACTCAGGTATGAGATCCTCACGCCAAACTCCATTCCCAAAGGATTCATGGATGGCAAACAGGCCTGTATGCTGATGG[T/G]GAGAGCAGTTTTATGTTTAAACAATATAAATAAAATCATTAGATGTCATTTGGATATGCCCTGGTGGATCATGAGGGAATTGAGTTGATCAAATCAGAAAAAAATAGGCTGAATCGATCTGCACATTGTCACCTTACAATTATAAGGTACTATCTGACATTTTTGTCAAAATTGAGTTATTCACATATTCTTTTTAAATGGCAACTTATTTACATGATGGGATGTGTTTTTATACATTGTTTACATTTTAAGGCTTTTTATTTAAAGGGCCATGAAACCCCCTCGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGTCAGAAAAGTGGGCGTGTCCAGCTCTGTTTAGGGGGGAGTGTCGGAGGAACTAAAGTGGGAGGGTGTGGGAGTGTCTATTTGTGCACGCGAGTTTCAGAGTCAAAATACACAGACAGGAGAAAGTGATGGTGTTTAACCTACATGGACATCTGTAGTCGAATTATTTGCCAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39978
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Essential Splice Site 1166 1686 26 36
ENSDART00000137105 None None 738 None 16
Genomic Location (Zv9):
Chromosome 3 (position 5739168)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5231139
GRCz11 3 5140980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTGGAGGACACACTCGACTCTACAGCCGCACAGCAGGAGCTCAGG[T/C]ATACACACACACACTCAACTCCACAGGTCTCTACGTGTAACTAAATACAG
Long Flanking Sequence:
TTTTTATAGCAGATGCCGCTCTATTCTGGTTTTTGTAGCAGTTGGTGCTCTAGGCTAGTTTTTGTAGCAGACGGCGCTCTAGGCTAGTTTAATAACAGATGGCGCTCTAGGCTAGTTTTAATCGCAGATGGTGCTCTAGGCTAGTTTTTATAGCAGATGGCGCTCTAGGCTAGTTTTTATAGCAGATGGAGCTCTAGTCTAGTTTTTATAGCAGATGGCGCTCTAGGCTAGTTTTTATAGCAGATGGAGCTCTAGTCTAGTTTTTAAACCGCAGTTTGTGTTGCAGGATTGAGGAGGAGGCGGCGCAGAAGAATCTGGCCCAGAAGAAGATCCGCGAGCTGGAGTCTCAGCTCAGTGAACTGCAGGAGGATCTGGAGCTGGAGAGAGCGGCTCGAACCAAAGCCGAGAAACACCGCAGAGACCTGGGGGAGGAGCTGGAGGCGCTGAAGACTGAGCTGGAGGACACACTCGACTCTACAGCCGCACAGCAGGAGCTCAGG[T/C]ATACACACACACACTCAACTCCACAGGTCTCTACGTGTAACTAAATACAGCTACTATAATAATAATAATATTTTACAGAGTTAAAGTTTGTTGTTGTCTGGATGTGTGTATTGCTGCAGGACGAAGCGTGAGACTGAAGTGGCGCAGCTGAAGAAGGCTCTGGAGGAAGATGCTAAAGTTCACGAGCAGGTGATGGCGGAGATCAGACAGAAGCACAGCCAGGCCTTCGATGAGCTCAACGAGCAGCTGGAGCAGGTCAAACGGGTAAGAGACACACACACACACAAATAGACAATCACACACACAAATAATCACACATATAAACAGACAAACACACATATAAGCACACAAATAAACACACAAATAAACACAGAATCACACACTAAAAAACACAAATAAACACACACAAACACACAATCACACACAAATATATAAACACACACTAATAAACACGATCACACACAAATAAGCAAACATACACACACAAATATATAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33082
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092373 Missense 1350 1686 31 36
ENSDART00000137105 None None 738 None 16
Genomic Location (Zv9):
Chromosome 3 (position 5736902)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 5228873
GRCz11 3 5138714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGCCAAGAGGAACCTGGAGAAGCAAATCGGCACTATGCAGGCGCAGG[T/C]ACACACAGCCTCAAAACACTATTCAATTCTGAGTGCACCTCACTCTATAT
Long Flanking Sequence:
CTAGTCACTTTGTAAACCTTAGCAGCTGCCTAGCAACCACATAGTAAAACCACAGCAACTCCCTGATAGCGGCCTAGTAACCACATTGCAACTGCCTAGCAACACCCTAGCAGCTACAATGCTTTGCTACTGCTAACGTCTGTGTGTTGTGTTCAGGCTGAGCTGGATAACGTCAACACTCTGCTGAGCGACGCTGAAGGAAAGTCCATCAAAGCGTCCAAGGACTGCTCCACCGTGGAGTCGCAGCTGCAGGACGTGCAGGTACAGCGGAGACATCATGGGGCATCTGCAGGTTTGTATGTGTGTGTTACTGACCCTGAGTGTGTGTGTGTGTGTGTGTCCACAGGAAGTGCTGCAGGAGGAGACCCGTCAGAAGCTGGCTCTGAACACTCGCCTGCGTCAGCTGGAGGACGAGCAGCACAGCCTGAGGGAGCAGCTGGAGGAGGAGGAGGAGGCCAAGAGGAACCTGGAGAAGCAAATCGGCACTATGCAGGCGCAGG[T/C]ACACACAGCCTCAAAACACTATTCAATTCTGAGTGCACCTCACTCTATATGGAGAATAAAGCCCGCCCTCTAGTACAGGAGCCAATCATCAATCACTATATGGCGAATAAAGCCCGCCCTCTAGTACAGAAGCCAATCATCGATCACTATATGCCGAATAAAGCCCGCCTACTAGTATAGGAGCCAATCATTGATCACTATATGCCGAATAAAGCCCGCCTTCTAGTACAGGAGCCAATCATCGATCACTATATGGCGAATAAAGCCCGCCCTCTAGTACAGAAGCCAATCATCCATCACTATATAGAGAATAAAGCCCGCCTTCTAGTACAGGAGCCAATCATTGATCTCTACATGGAGAATAAAGCCCGCCTTCTAGTACAGGAGCCAATCATCGATCTCTACATGGAGAATAAAGCCCGCCTTCTAGAACAGGAGCCAATCATCGATCTCTACATAGAGAATAAAGCCCGCCTTCTAGTACAGGAGCCAATCATCCA
Associated Phenotype:
Not determined