Busch Lab

ZMP

unk

Ensembl ID:
ENSDARG00000000935
ZFIN ID:
ZDB-GENE-040426-707
Description:
RING finger protein unkempt homolog [Source:RefSeq peptide;Acc:NP_956530]
Human Orthologue:
UNK
Human Description:
unkempt homolog (Drosophila) [Source:HGNC Symbol;Acc:29369]
Mouse Orthologue:
Unk
Mouse Description:
unkempt homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2442456]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12996 Nonsense Available for shipment Available now
sa740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12996
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001053 Nonsense 177 737 3 15
ENSDART00000131300 Nonsense 177 777 3 15

The following transcripts of ENSDARG00000000935 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 37222914)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35763554
GRCz11 12 36436295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAYTGTGCCTTTGCTCATGGGTCACATGACCTCAGAAGCCCTGTATA[T/G]GACATCAGGTGWGTAGCTGGTCTTCAGAGCAGTATTTCATCTGTATTTCA
Long Flanking Sequence:
TGGTTCGGAAACTTTATTTAAAAAATTAAGTTTATCTACTACTTTTTTAATGTTGGGATCAAATGGACGCTGTACAGATACTGCAGTTTTGTGGGTTATGTTATCTTCATTTCATCATTTAGTTTCTACATAGACCTGCATTCATTCGCCTCTCTCTACCTACTGAATTCATGAATCAGTGGGTGGAGCTGAACAGCCAATAGTGGACAAAATGAATGTTTTGAAACCTATAGGATGTTTTTAATTGTACAGAAACCTCTTATATGTCAAAAGAGCAAGCTAATTTTGATTCCTCAGTTTATAACCCCTTCAAAATATGTGTCTATTGGCAGGTGTCCATTTCTACACAGAACAGCTGGAGACACAGAGAGGCGGTATCACCTGCGCTACTATAAGACCGGCTCCTGTATCCACGAGACTGATGGAAAGGGGCACTGCAGTAAAAACGGCCCTCACTGTGCCTTTGCTCATGGGTCACATGACCTCAGAAGCCCTGTATA[T/G]GACATCAGGTGTGTAGCTGGTCTTCAGAGCAGTATTTCATCTGTATTTCAAACTTCTTATTAACATTTTGCACCAAATCATGCTAATAACATGCTCATTCATGCTAGATTCAGTGCTAGAAACATGTTAATTCATTCTAGAATCATGTTAAGTTCATGCCAATTCATGCTAGAATCATGCTAGTAACATACTAAGTCATGCTAGAACCTTGCTAGTAACATGCTAATTCATGCTAGATTCATGCTAGAAACATTTTAATTCATGCTAGAATCATGTTAGTAACATGCAAATTCATGCTAGAATCATTCTAGTAACATGCTAGTAACATGCTAATTCATGCTAGAATCGTGCTAGTAACATGCTAATTCAATCTAGAATCATGCTAGTAGCATGCTAATTCATGCTAGATTCAGGGCTAGAAACAAGTTAATTCATGCTAGAATCATGCTAATAACATGCTAATTCATGCTAGAGTCATGCTAGTAACATGCTAATTCATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27997
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001053 Essential Splice Site 576 737 12 15
ENSDART00000131300 Essential Splice Site 576 777 12 15

The following transcripts of ENSDARG00000000935 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 37196854)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35789614
GRCz11 12 36462355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAGCCAATCAGAAAGCAGTTTTTTGGGGACGTCCCACGGTTCTTTAGG[T/C]CTGCTATTTTTAGTTTTATATTTTATTTTATTTTTTTCTGCTTTATTTTT
Long Flanking Sequence:
CTCAAGGGGCTGCACTATTTATTTTTGAACTCAAATGTATTTTGTGGAATATTTGGAGACTGGACATCTATAGCAGGAAAAAGATACTATGAAATCAATTATTTCTCCCTCTTCACTAGAATCTGCATTGGATGATCTGGACCTGAATGACTTTGGAGTATCGGCTCTTGAGAAAAGTCTGGAGAGTTCAGCTCTACCCAGCATGGGCCTCATGTTAGGTCGGTGATGAGGTTTACTCTTTAAAAAAAAAAAAAAAAAAACATACCTTAAAGAATCAGTGCTGAAATTCATCCTGTGTTCTTTCTTCCTGCAGGAGGCAGTCAATTACAGAGTTCAGCACCTGTCAACATCCCTGGCTCTTTAAGTAGCCCCTCCCCTTTCAGATCGCCCTCACCTTCTCCACCAATCAGAGCCCACCACTCGCCATTCCTCTCAGCACAGCTGCCACAACCTAGCCAATCAGAAAGCAGTTTTTTGGGGACGTCCCACGGTTCTTTAGG[T/C]CTGCTATTTTTAGTTTTATATTTTATTTTATTTTTTTCTGCTTTATTTTTAAATAGGGTCAGAAAGAGTTTAGATTTCCTGAATATCAAGGCCAGAAATAAAATTCTTACAAATTTATTATTACTATAATATATTTCTTCACATTTTTTTTGTAAACCAAAAATAATAATAATAATAATAATAATAATAATAAAAAAAAATATATATAGATAGATAGAGAGAGAGAGAGAGAGAGAGAGAGTTGAGGTCTGAATTATTAGCCCCCCTGAATTTTTAGCCCCCCTGAATTTTTAGCCCCCCTGTTTTTTCCCCCAATTTCTGTTTAACGGGGAGATTTTTTCAATACATTTCTAAACATATTAGTTTTAATAACTCATCTCTAATAACTGATTTATTTTATCTTTGCCATGATGACAGTAAATAATCTTTGACTACATATTTTTCAAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTTAACTAGGTTAATTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa740
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001053 Nonsense 647 737 14 15
ENSDART00000131300 None 646 777 14 15

The following transcripts of ENSDARG00000000935 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 37190309)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35796159
GRCz11 12 36468900
KASP Assay ID:
554-0647.1 (used for ordering genotyping assays)
KASP Sequence:
TGATTGTATTTTTTNCTGTCTTAGTCCCTGGCGGTGTTGAAGGCGGATGC[G/T]GAGGACGCTCGTCTACTGGCAGGGCAGCTGGGAATGGAGGCGGARCGAGC
Long Flanking Sequence:
AGGAAAGATTCTGAATATTATTAAGTGATATGGGACCCTATGATAGTACACACACATGGGTAGTATAATATAAGTATTAATATGTGTATTGTGTGTATTAATAGTGGAGTGCAGTATTTGGTAGAATAACCCCAGTTTTCAATCACACAAAATGAACATATTTGTTTTTTCTGATCAGATTTGAAGAAATGTTATTCTAAAATAAAATTCTCAAAGCCATATCTACTAAAAATTTGTGAATAAATAAATAAATAAACTAAAACCTACTAGATTTTATATAAGATAATCCACTTCACACATATGTAGTATGTGTATATCGTAGTTAATAATAAAAATCAATAGTATCTAGGATCTATGCATAATATAGAGCTACAGCTAAACTGTTAAGGGATTAATTGTGTTTTTTTTTGTATTTTTTTGATTGTATTAATTGTGGTTTGATCACTGTTTTGATTGTATTTTTTTCTGTCTTAGTCCCTGGCGGTGTTGAAGGCGGATGC[G/T]GAGGACGCTCGTCTACTGGCAGGGCAGCTGGGAATGGAGGCGGAACGAGCACGGCAGGCAGAGGTGGAGGCGCAGCAGCAGGCCGCTCTCCTGGAGGAGGCGCTGGAGACTCTCAGACATGCGGAAAACCCTCATCTACAGCTCCACCAGCTCCAGCTCCTGCACAGACTGCCTCTCAGCTCCATCTGCAGCCTGCAGGCACAGATCTGCTCCTGCCTGCGCACTGTAGAACAGGTAGGCACACAGCTGATACCTCTAAACTCAACATAATCACCAGAAATCATGATGTTTAATCCAAAAATTAGTGAGAAGATTTTTTATTCTCTATAAGTGTGTTTTAGAGCAGTTTGTATTATCTAAGAGTGTGTGCAGCAAACATGCCAGCATGTGAACTAAAGATACTGTGGTACTGTATGTGTAAAATGAGGCCACAGAGGTGTTGGAATATTCAGAAACCTCACTGGATAAACCAATCACAAAATAAACCTCAATAAAATAAA
Associated Phenotype:
Not determined