Busch Lab

ZMP

skap2

Ensembl ID:
ENSDARG00000000906
ZFIN ID:
ZDB-GENE-030616-438
Description:
Src kinase-associated phosphoprotein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6PG29]
Human Orthologue:
SKAP2
Human Description:
src kinase associated phosphoprotein 2 [Source:HGNC Symbol;Acc:15687]
Mouse Orthologue:
Skap2
Mouse Description:
src family associated phosphoprotein 2 Gene [Source:MGI Symbol;Acc:MGI:1889206]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5891 Nonsense Mutation detected in F1 DNA Not yet available
sa17960 Nonsense Available for shipment Available now
sa14097 Nonsense Available for shipment Available now
sa6423 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5891
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052660 Nonsense 127 341 6 13
ENSDART00000137344 None None 185 None 8
Genomic Location (Zv9):
Chromosome 16 (position 23031666)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21141417
GRCz11 16 20947236
KASP Assay ID:
554-3954.1 (used for ordering genotyping assays)
KASP Sequence:
AAATCACCTCCTTTTGATTTCTAGATCATAGCTTCTTTGGCAATGAGTGG[C/T]AGAAGAGATGGTGTGCCTTGAACAACAGCATATTCTACTACTATGGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17960
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052660 Nonsense 149 341 7 13
ENSDART00000137344 None None 185 None 8
Genomic Location (Zv9):
Chromosome 16 (position 23031844)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21141595
GRCz11 16 20947414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAAATCTGAATTNNNNATAATCTACATTAATGTTCACTAGACAAACAG[C/T]AAAAGGGAGAGTTTAATATTGTTGGGTACACTGTCAAAATGAACAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052660 Nonsense 179 341 7 13
ENSDART00000137344 Nonsense 23 185 1 8
Genomic Location (Zv9):
Chromosome 16 (position 23031935)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21141686
GRCz11 16 20947505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACAACACTCTGYGGAAAGATGCAAAGCGAGATTGCTGCTTTGAGGTTT[C/A]AGCTCCAGACAAGCGTGTATATCAGGYTAGTSTCTACTACCATGTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6423
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052660 Essential Splice Site 187 341 None 13
ENSDART00000137344 Essential Splice Site 31 185 None 8
Genomic Location (Zv9):
Chromosome 16 (position 23031962)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21141713
GRCz11 16 20947532
KASP Assay ID:
554-5315.1 (used for ordering genotyping assays)
KASP Sequence:
GCGAGATTGCTGCTTTGAGGTTTCAGCTCCAGACAAGCGTGTATATCAGG[T/C]TAGTSTCTACTACCATGTTAAAATATGTGATGANTTTTTTTTGYTAACTTA
Associated Phenotype:
Not determined