Busch Lab

ZMP

dstyk

Ensembl ID:
ENSDARG00000000853
ZFIN ID:
ZDB-GENE-040826-2
Description:
Dual serine/threonine and tyrosine protein kinase [Source:UniProtKB/Swiss-Prot;Acc:Q4VSN1]
Human Orthologue:
DSTYK
Human Description:
dual serine/threonine and tyrosine protein kinase [Source:HGNC Symbol;Acc:29043]
Mouse Orthologue:
Dstyk
Mouse Description:
dual serine/threonine and tyrosine protein kinase Gene [Source:MGI Symbol;Acc:MGI:1925064]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa37393 Nonsense Mutation detected in F1 DNA Not yet available
sa24044 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29678
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637 Nonsense 275 857 3 13
ENSDART00000106645 Nonsense 275 885 3 14
Genomic Location (Zv9):
Chromosome 22 (position 464744)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 451852
GRCz11 22 489575
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACGCAGCTAGCGTCGCTGCAGCTGATTAGCGCCTCCGCGGGGAACTG[C/A]GCCTGCGGAGCTCCAGCAGCTCAGAGCGCCGGCCGCATGCAGGGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637 None None 857 None 13
ENSDART00000106645 Nonsense 509 885 6 14
Genomic Location (Zv9):
Chromosome 22 (position 458934)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 446042
GRCz11 22 483765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCCACTCCGGTTCATCCGTCACGCGTCTCTTCTGGGAGCAGATCAAA[C/T]AGGTACGTTATCCACAGCGCCCCGCTCATCTGATTACCCATGATGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637 Nonsense 498 857 6 13
ENSDART00000106645 Nonsense 526 885 7 14
Genomic Location (Zv9):
Chromosome 22 (position 458807)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 445915
GRCz11 22 483638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCCACCGCATCACATGGGTCAATCCTCCAGCCATCACGGCCGAGTG[G/A]AAGCGGAAGGTCGCGCAGGACGCCATCGAGAGCCTGAGCGCCGCCAAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4188
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067637 Nonsense 733 857 11 13
ENSDART00000106645 Nonsense 761 885 12 14
Genomic Location (Zv9):
Chromosome 22 (position 450526)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 437634
GRCz11 22 475357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCAGCTGGACAAGCAGAACCGGGCGAAGATCACGGATCTGGGCTTYTG[T/A]AAACCCGAGGCCATGATGTCCGGCAGTATCGTGGGGACGCCCATCCACAT
Associated Phenotype:
Not determined