Busch Lab

ZMP

ankar

Ensembl ID:
ENSDARG00000000516
ZFIN ID:
ZDB-GENE-030616-533
Description:
ankyrin and armadillo repeat containing isoform 2 [Source:RefSeq peptide;Acc:NP_001035135]
Human Orthologue:
ANKAR
Human Description:
ankyrin and armadillo repeat containing [Source:HGNC Symbol;Acc:26350]
Mouse Orthologue:
Ankar
Mouse Description:
ankyrin and armadillo repeat containing Gene [Source:MGI Symbol;Acc:MGI:2442559]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41501 Nonsense Mutation detected in F1 DNA Not yet available
sa30922 Nonsense Mutation detected in F1 DNA Not yet available
sa34717 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41501
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536 None None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
ENSDART00000000536 None None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
Genomic Location (Zv9):
Chromosome 9 (position 42148426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41273596
GRCz11 9 41075383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAA
Long Flanking Sequence:
AATAAAAATAAAATGATGCACAATTCCATGTTAGATTCTGTATAATTTCCATTAATAAAATTAATAAATCATTAACTTAATTATTGCATGTCTTTGATCATTATAAACTGAAATATTATCGCAGTGACATTAAAATAACACTGATTTGTATCACCAGGTTTAAAAGACATCTCAGATGAACCATGTTATCAGGACATTTATAAGGAGAACACTGATGCAGACCCAACCTATGAACCCGAAAGCACAGAAGAGGAGAATCTCTTCTCTCAATACTCAGAAAGCATCCTGATCAAGCTGAGTGCATTCCTGACCTCTGCCCGCCAGCACCAAAATCTCTTCATGTTCGAGGGGTCTTATTGCCTGTCCAATGCTGTCCGACTCACAGAAGACAATATTGATCTGGCCACATACCAGAGGCTGCAGAAAAGGCTGTCAGAGCACATTATTTTGGTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAAGATGTTGATTCCAAATCTGTCAAAATTGCTCTCACCTATGTCAGGTTTGTGTTGTCTTTTTTATATTTAATCAAAAATATATACATTAATTAATTAGTTAATTATTTATTTATTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTATTTTTTTTATTTATTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGGCAGGGACAGTGTACATTAATTAACATTTCTGCAAATGCACCAGAGTTAGCCAGAAGGCTATTTTTTATCTGTTGTCCCTGAACAACCTAAAAAAAACAATACAAGAATTATCCAATCAATCAAACATAGTTAAGAAGTACTAAAATATACATAGTTTTGTAGATCTTAATAAAAAATTTATATATACAAATTAAACTAAAACACCAACATTTTGTAATAGAGATAAAAATAGTTGAAACGCATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30922
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536 None None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
ENSDART00000000536 None None 644 None 13
ENSDART00000100342 Nonsense 298 1400 2 23
ENSDART00000125843 Nonsense 285 1328 2 21
Genomic Location (Zv9):
Chromosome 9 (position 42148426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41273596
GRCz11 9 41075383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAA
Long Flanking Sequence:
AATAAAAATAAAATGATGCACAATTCCATGTTAGATTCTGTATAATTTCCATTAATAAAATTAATAAATCATTAACTTAATTATTGCATGTCTTTGATCATTATAAACTGAAATATTATCGCAGTGACATTAAAATAACACTGATTTGTATCACCAGGTTTAAAAGACATCTCAGATGAACCATGTTATCAGGACATTTATAAGGAGAACACTGATGCAGACCCAACCTATGAACCCGAAAGCACAGAAGAGGAGAATCTCTTCTCTCAATACTCAGAAAGCATCCTGATCAAGCTGAGTGCATTCCTGACCTCTGCCCGCCAGCACCAAAATCTCTTCATGTTCGAGGGGTCTTATTGCCTGTCCAATGCTGTCCGACTCACAGAAGACAATATTGATCTGGCCACATACCAGAGGCTGCAGAAAAGGCTGTCAGAGCACATTATTTTGGTTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTTGCTTA[T/A]CTCAAACTCATCTCGTTCCTTGTGCCACTGCTCATTTCTTTGAGGAAAAAGATGTTGATTCCAAATCTGTCAAAATTGCTCTCACCTATGTCAGGTTTGTGTTGTCTTTTTTATATTTAATCAAAAATATATACATTAATTAATTAGTTAATTATTTATTTATTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTATTTTTTTTATTTATTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGGCAGGGACAGTGTACATTAATTAACATTTCTGCAAATGCACCAGAGTTAGCCAGAAGGCTATTTTTTATCTGTTGTCCCTGAACAACCTAAAAAAAACAATACAAGAATTATCCAATCAATCAAACATAGTTAAGAAGTACTAAAATATACATAGTTTTGTAGATCTTAATAAAAAATTTATATATACAAATTAAACTAAAACACCAACATTTTGTAATAGAGATAAAAATAGTTGAAACGCATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536 Nonsense 58 644 2 13
ENSDART00000100342 Nonsense 773 1400 11 23
ENSDART00000125843 Nonsense 751 1328 10 21
Genomic Location (Zv9):
Chromosome 9 (position 42132429)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41257599
GRCz11 9 41059386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAGTGCATGGCTACAGCGGTCCTGTGTCATATGACGGAAAACTCA[C/T]AAGTCTGTGAAGAACTGGTGCATCATGGTGCTGTACCGATTCTGATCAAG
Long Flanking Sequence:
TTATTGGGCATTACAGTACTTAATTGGTTTGAGTTCTCTTCATTTATAGGGTTTTACTTTGCTCAATTTACTTCATTTACTCAAAAAGTTTACAGTGCTCATTAGTTTTTGAACTTAAATGGTTTGTTGCAATCGGTTTCCTCAAAGGGTTTGAGCTACCCTAACTTTTTTGGTCTTACAGTGTTTTTAAATGTAAAATATAAATAATAAAATGCATATCTACCGTAAAAAAACATATAACAATATTTTCCTATTTTCCACATTTTTGAAACAAACATTGTTGCTGTATTGAATTCATCTTGAAACATAAAATCTGAGTTCTGAAGCAAAACGATTGAGAACCACTGATCTAAAAGATAGAAAGATGTTAGCAGATTGTGTAATGCTTCTGTTGCTGTGTTTCAGGAGGTGTTCCAGTGCTGGTGAGCTTGCTTTGTTCAGACAGACAGGTGGTGCAGTGCATGGCTACAGCGGTCCTGTGTCATATGACGGAAAACTCA[C/T]AAGTCTGTGAAGAACTGGTGCATCATGGTGCTGTACCGATTCTGATCAAGCTCCTCAGTGTCCATCAGCCCGAGCTGGACTCTCGCTGTGCTGTTATACTTGCCGATCTGGCCGCACACAGCAAGCAGCACCAAAGCCTCATTGCTGACTTGGTAGGTCAAAAGTTACGCTATCTGTACACATTTGAGGACCCTACACTTACATGGGATTTTATTGGTCATATTTTAGTTTGGGAATGAATCCACGTTATTTAAGGGATAGTTCAACCAAAAATGCTAATTCTATCAATATTTACTCATTTATTTACTTATTACATTATTTATTATTTACCTATTTTAGTTTTATTGTTTTGTTGAACACAAAATAAGATGATTTGAAGTATGTTGAAATGCATTAACCATTGACTTAGTGTTTGTTTTTTCCAACTATGAGCCAATGGTTACAGGATTCCAGCATTCTTCAAAGTATTATCTTCTTTCGTGTTCATCAGAAAAAAACTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27453
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000536 Nonsense 99 644 2 13
ENSDART00000100342 Nonsense 814 1400 11 23
ENSDART00000125843 Nonsense 792 1328 10 21
Genomic Location (Zv9):
Chromosome 9 (position 42132306)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41257476
GRCz11 9 41059263
KASP Assay ID:
2260-2254.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGACTCTCGCTGTGCTGTTATACTTGCCGATCTGGCCGCACACAGC[A/T]AGCAGCACCAAAGCCTCATTGCTGACTTGGTAGGTCAAAAGTTACGCTAT
Long Flanking Sequence:
TTGTTGCAATCGGTTTCCTCAAAGGGTTTGAGCTACCCTAACTTTTTTGGTCTTACAGTGTTTTTAAATGTAAAATATAAATAATAAAATGCATATCTACCGTAAAAAAACATATAACAATATTTTCCTATTTTCCACATTTTTGAAACAAACATTGTTGCTGTATTGAATTCATCTTGAAACATAAAATCTGAGTTCTGAAGCAAAACGATTGAGAACCACTGATCTAAAAGATAGAAAGATGTTAGCAGATTGTGTAATGCTTCTGTTGCTGTGTTTCAGGAGGTGTTCCAGTGCTGGTGAGCTTGCTTTGTTCAGACAGACAGGTGGTGCAGTGCATGGCTACAGCGGTCCTGTGTCATATGACGGAAAACTCACAAGTCTGTGAAGAACTGGTGCATCATGGTGCTGTACCGATTCTGATCAAGCTCCTCAGTGTCCATCAGCCCGAGCTGGACTCTCGCTGTGCTGTTATACTTGCCGATCTGGCCGCACACAGC[A/T]AGCAGCACCAAAGCCTCATTGCTGACTTGGTAGGTCAAAAGTTACGCTATCTGTACACATTTGAGGACCCTACACTTACATGGGATTTTATTGGTCATATTTTAGTTTGGGAATGAATCCACGTTATTTAAGGGATAGTTCAACCAAAAATGCTAATTCTATCAATATTTACTCATTTATTTACTTATTACATTATTTATTATTTACCTATTTTAGTTTTATTGTTTTGTTGAACACAAAATAAGATGATTTGAAGTATGTTGAAATGCATTAACCATTGACTTAGTGTTTGTTTTTTCCAACTATGAGCCAATGGTTACAGGATTCCAGCATTCTTCAAAGTATTATCTTCTTTCGTGTTCATCAGAAAAAAACTTTATCTTTTTGGATCATGTCGTGGGTGAGTAAATAATGACAGATTTCTCATTTTGGGATAAACTATCCATTTAATTATTGACTATGACTTTTTCTCAGACTAACATTTTTATAATAATAGCTTA
Associated Phenotype:
Not determined