Busch Lab

ZMP

cntn2

Ensembl ID:
ENSDARG00000000472
ZFIN IDs:
ZDB-GENE-990630-12, ZDB-GENE-990630-12
Description:
contactin-2 [Source:RefSeq peptide;Acc:NP_571521]
Human Orthologue:
CNTN2
Human Description:
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
Mouse Orthologue:
Cntn2
Mouse Description:
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa41829 Nonsense Mutation detected in F1 DNA Not yet available
sa9412 Nonsense Available for shipment Available now
sa19006 Nonsense Mutation detected in F1 DNA Not yet available
sa41830 Nonsense Mutation detected in F1 DNA Not yet available
sa35078 Nonsense Mutation detected in F1 DNA Not yet available
sa41831 Nonsense Mutation detected in F1 DNA Not yet available
sa21903 Nonsense Available for shipment Available now
sa12173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 40 853 2 18
ENSDART00000103800 Nonsense 38 412 2 10
Genomic Location (Zv9):
Chromosome 11 (position 24886566)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23725865
GRCz11 11 23963722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGGATGTGTGTGTGTCGGGTCATGACAGTGGGCCGGTGTTTGAAGAG[C/T]AGCCATCTAGTCTGATTTACCCAGAGGGGATGCCAGAAGGCAAGGTGACC
Long Flanking Sequence:
TAATACAAGGCTATATAAGCTTAAAAATAAGGGGAAATTATCATTGTTGTCATCTCAGATGGAAACATTGTAGCCAATCAAACGCTGCCTGGTAATTGTATTAATTGTATTAAATTGTATTTTTAATTTTTTTTTTTGTAAAAAGTCAGAGACTGTGTTTTGCTCGAATTGGCACGTGTTTCACTGGGCTTTTAAACTCAGGATTTAAATGAGAACAAGGGAACAATGGTATTTGAGGCTCACAGTTTGTCATTTCCATGTTCTGAACTCTTATTATTTAGCTATGCCTAGGCATATCCAGATTTTCATTCTATGGCTTTTTAACATTTAAAATTAGCTTTGGTGCACTGCATTAAACTGTGAATGCTTTGTGAAAGTGTACACCTCATTAGGTGTTTAACCTGTTTAGACTCTTTCTGAAAGACATTGTTTGTTACTTTTTTTTGGTAGGTGGGGATGTGTGTGTGTCGGGTCATGACAGTGGGCCGGTGTTTGAAGAG[C/T]AGCCATCTAGTCTGATTTACCCAGAGGGGATGCCAGAAGGCAAGGTGACCCTGAGCTGCCAGGCTCGCTCCAGCCCTGCTGCTGTTTACCGGTACTCACATCACATTTTTGTCATTTACACGTGAACGAACAAAACACGACCTTTACTTGCTTTGTATGACTCATAGTTAAACAAAAACCAACATATTTTACTAAATAGCATATTAAAATTAAATATTTTATGTGTTTGAAGTATCTGTTTAATAAAGCTGCTTTACAAAATTAGTAAAATATTCAAATATGTCAAATATTAATCCAATTTCAGTTAATTTCTGTTTTAATACATTTTTAAATAAAGTTTTGGTTTGTGATGGCTAAACTGAACTTTACAGTCTACATTGTGTCACATGATCCCTCAGAAAACTGGTTCTCAAATTTAAATAAATATATGGTTATTATTATTATTATTATTATTATTATTATTATTATTATTAGTGGTGTAACAGATAACAAATCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9412
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24888728)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23728027
GRCz11 11 23965884
KASP Assay ID:
2260-4257.1 (used for ordering genotyping assays)
KASP Sequence:
CTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCRGCACCATTGTTAGCCGCGTCGCTAATCTCAA
Long Flanking Sequence:
GTTCCGATCTGTACGAATCACAGATCAACTGTGATCCATTAACACCCCTAATTATTATTAATGATTAAAAAAGCTGTGCTGCTTAATTTGTTTATGGAACATGGAATTTTTTTGCTATTTAGTACTTCTGATTTCCAAAGTGATTTCCAAAGTTTTTTATCATACTGTTTTTTTATATATATTATATAATTGAGATCCAGTTTTATATGTAATTTTGACAAAGAAAACTTGAAGATACAATGTATTTGATGAGAGCAGTTTTTAAGTAGATTATTGATATTTCAATAAAATCAATAAAAATATACTATATATATGGCAAATTGGTTATTGACTTTCCTTTACTCTGGTAATAAAGTCAGATCTTGTGTGTGATTTCCTCCCAGGTGGCGTGTGAATGGCACTGACATATCATTTGCTGAAGAGTCGCACTACACACAGGTTGCAGGAAACCTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCGGCACCATTGTTAGCCGCGTCGCTAATCTCAAGTTCGGCTGTGAGTAACCATTGTCCAAGTAGAAAACTGGGTCTTGTCTACTACTCGTGCTTGATTTATACTGTGCTTTCTTCCAGACCTGCATGATTTTCCCCCTGAGAGCAGAAGTCCTCAGACGGTCCATGAAGGAATGGGAACATTTCTTGCCTGCCAGCCACCAGCTCATTACCCAGGTAAACACACACACATATCAGTTAGCAAAACATTTCACTCTTTTTTTATTTCGTTAACTCTTGCATCCCTTCTGTTTGTTAGCTTTGTCCTACCGCTGGTTTATCAACGAGTTCCCTAACTTCATCCAGCCAGAAGCGGGCAGGTGGTTTGTTTCTCAGGTCACTGGTAACTTGTATCTTGCTAACGCGAGAGCCAATGACACGGGCAACTATTTCTGCTTCACCACCATCAACATGGATGTCAGCACCAAGAGCATCTTCAGCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19006
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
ENSDART00000000486 Nonsense 109 853 3 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24888728)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23728027
GRCz11 11 23965884
KASP Assay ID:
2260-4257.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCGGCACCATTGTTAGCCGCGTCGCTAATCTCAA
Long Flanking Sequence:
GTTCCGATCTGTACGAATCACAGATCAACTGTGATCCATTAACACCCCTAATTATTATTAATGATTAAAAAAGCTGTGCTGCTTAATTTGTTTATGGAACATGGAATTTTTTTGCTATTTAGTACTTCTGATTTCCAAAGTGATTTCCAAAGTTTTTTATCATACTGTTTTTTTATATATATTATATAATTGAGATCCAGTTTTATATGTAATTTTGACAAAGAAAACTTGAAGATACAATGTATTTGATGAGAGCAGTTTTTAAGTAGATTATTGATATTTCAATAAAATCAATAAAAATATACTATATATATGGCAAATTGGTTATTGACTTTCCTTTACTCTGGTAATAAAGTCAGATCTTGTGTGTGATTTCCTCCCAGGTGGCGTGTGAATGGCACTGACATATCATTTGCTGAAGAGTCGCACTACACACAGGTTGCAGGAAACCTTGTGATCAACAACCCTCAGAATGGGCGAGATGGCGGCTCGTACCAGTG[T/A]CTCGCAATCAACCGATGCGGCACCATTGTTAGCCGCGTCGCTAATCTCAAGTTCGGCTGTGAGTAACCATTGTCCAAGTAGAAAACTGGGTCTTGTCTACTACTCGTGCTTGATTTATACTGTGCTTTCTTCCAGACCTGCATGATTTTCCCCCTGAGAGCAGAAGTCCTCAGACGGTCCATGAAGGAATGGGAACATTTCTTGCCTGCCAGCCACCAGCTCATTACCCAGGTAAACACACACACATATCAGTTAGCAAAACATTTCACTCTTTTTTTATTTCGTTAACTCTTGCATCCCTTCTGTTTGTTAGCTTTGTCCTACCGCTGGTTTATCAACGAGTTCCCTAACTTCATCCAGCCAGAAGCGGGCAGGTGGTTTGTTTCTCAGGTCACTGGTAACTTGTATCTTGCTAACGCGAGAGCCAATGACACGGGCAACTATTTCTGCTTCACCACCATCAACATGGATGTCAGCACCAAGAGCATCTTCAGCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 261 853 6 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24889426)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23728725
GRCz11 11 23966582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCCCGCTGAGACATACGCTTTATCAGGGCAAACCGCACAGCTGGAATG[C/A]TTTGCCTATGGCAAGTAAGTCCCCCTTAACTCCTAGAGATCACTGCAGCA
Long Flanking Sequence:
TTTCTTGCCTGCCAGCCACCAGCTCATTACCCAGGTAAACACACACACATATCAGTTAGCAAAACATTTCACTCTTTTTTTATTTCGTTAACTCTTGCATCCCTTCTGTTTGTTAGCTTTGTCCTACCGCTGGTTTATCAACGAGTTCCCTAACTTCATCCAGCCAGAAGCGGGCAGGTGGTTTGTTTCTCAGGTCACTGGTAACTTGTATCTTGCTAACGCGAGAGCCAATGACACGGGCAACTATTTCTGCTTCACCACCATCAACATGGATGTCAGCACCAAGAGCATCTTCAGCAAAGCTGTCCAGCTCACAGTTCACCCTGATGGTTAGTTCAAAGCCTTATATTTCCTTCAGCAACAAGCTCAAAAACTGAATCTTATTTTTTTTTTTTTTGCTGTGTTTCTTCAGCAAGCCCAAGGAAAACTGCTCCAAATATCCGAGTGCGTTTTCCCGCTGAGACATACGCTTTATCAGGGCAAACCGCACAGCTGGAATG[C/A]TTTGCCTATGGCAAGTAAGTCCCCCTTAACTCCTAGAGATCACTGCAGCATCGCTTTAACATAATCCATATCGCAGTCAGCTATAAAAATGTAACCATTTTTTCCATCATGCTCTCACTTTTACTTTTCCTCCTTTAGTCCGATTCCTAAAATCCGCTGGAGGAAGGTGGATGGAATTTTACCCCCTAAGGTTGGAACAAGTGTGGATGGGCCCATCTTGATTATTCCTGAACTGAATTTCGATGACGAGGGCATGTATGAGTGTGAGGTTTACAACTCAGAAGGCCGTGAGACGCATCAGGGACGTGTTTCTGTGCAAGGTAGGCATAGTATTAGAAATAGACAGAAATATAAATATTTTTCTCATGAACATTAAGTAGGGCAACACGGTGGCTCAGGGGTTAGCACTGTCACCTCACAGCAAGAAGGTTCAAGCCCCGACTGGGTCAGCTGGCATTTCATTTCCTCCAGGTGCTCTGGTTTCCAAAGGCATGCGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35078
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 311 853 7 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24889700)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23728999
GRCz11 11 23966856
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCCTGAACTGAATTTCGATGACGAGGGCATGTATGAGTGTGAGGTTTA[C/A]AACTCAGAAGGCCGTGAGACGCATCAGGGACGTGTTTCTGTGCAAGGTAG
Long Flanking Sequence:
GTCAGCACCAAGAGCATCTTCAGCAAAGCTGTCCAGCTCACAGTTCACCCTGATGGTTAGTTCAAAGCCTTATATTTCCTTCAGCAACAAGCTCAAAAACTGAATCTTATTTTTTTTTTTTTTGCTGTGTTTCTTCAGCAAGCCCAAGGAAAACTGCTCCAAATATCCGAGTGCGTTTTCCCGCTGAGACATACGCTTTATCAGGGCAAACCGCACAGCTGGAATGCTTTGCCTATGGCAAGTAAGTCCCCCTTAACTCCTAGAGATCACTGCAGCATCGCTTTAACATAATCCATATCGCAGTCAGCTATAAAAATGTAACCATTTTTTCCATCATGCTCTCACTTTTACTTTTCCTCCTTTAGTCCGATTCCTAAAATCCGCTGGAGGAAGGTGGATGGAATTTTACCCCCTAAGGTTGGAACAAGTGTGGATGGGCCCATCTTGATTATTCCTGAACTGAATTTCGATGACGAGGGCATGTATGAGTGTGAGGTTTA[C/A]AACTCAGAAGGCCGTGAGACGCATCAGGGACGTGTTTCTGTGCAAGGTAGGCATAGTATTAGAAATAGACAGAAATATAAATATTTTTCTCATGAACATTAAGTAGGGCAACACGGTGGCTCAGGGGTTAGCACTGTCACCTCACAGCAAGAAGGTTCAAGCCCCGACTGGGTCAGCTGGCATTTCATTTCCTCCAGGTGCTCTGGTTTCCAAAGGCATGCGCTATAGGTAAATTGAATACACTAAAGTGTCCATAGTGTATGTGTGTGAATGAGTGTCTAATGATGTTTCCCAGTACTGGGTTGTGGCTGGAAGGGCATCCGTTGCATAAAACATATGCGAGATAAGTTGATGGTTCATTCCTCTGTGGCACCCCCAAATTAATTAAGGGATAAGCCAAAGGAAAATGAATGAATGAATGAATGAACATTAAGTCGAAGCTTGATGCAATATAAACTTTGCGAGCAAGTGTGTTGTTGTTGTAGACAAAACTAAAATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27782
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Essential Splice Site 466 853 10 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24893082)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23732381
GRCz11 11 23970238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACTCTCTTCTGGAGCCGCGGCACAGAGTTACTGACTAATAGTACAAGG[T/G]AATACAGTAATCAAGTGTTTTAAAGGCCTCCAGATGTCTTGATCGATCAG
Long Flanking Sequence:
TATGCAGGATCGTGTTGAAGTGAATAACGGCCGGCTGAAAATCGCTAATCTTGCCCTGGAGGATTCTGGGATGTATCAGTGTGTGGCTGAAAACAAACACAGCACCATTTACTCGAACGCTGAGCTCAGAGTTCAAGGTGAGCGCAAGACAATCTCAGCATGAAAACACATCGGAAAATATAGTTGCATAAACACTGACTGTGTCTTGTTGTGTATGTTAATACACTTTAAACCCCTTTCTGCCAACCCAGCCATGCCTGAACCCCAGTTATAGTATAATCAGTGGTTAAATCCTCTTTGTGTGGTTACCCATTTCCCGTCCTGCCCCGTCCTGTCACCCTCTTTCAGTCCAGGCTCCAGACTTCAGGCTGAATCCAGTACGGAAGCTGGTTCCTGCTGCCCGTGGTGGACAGGTCAAAATGGAGTGTAAACCTCGGGCAGCTCCCAAACCCACTCTCTTCTGGAGCCGCGGCACAGAGTTACTGACTAATAGTACAAGG[T/G]AATACAGTAATCAAGTGTTTTAAAGGCCTCCAGATGTCTTGATCGATCAGATAGAGGGGAGCTGTAGATGATTTTAGTAGCAGTATGGTGTGTATGAACTCTCTTCAGGATAACCGTGACTCCGGATGGGATTTTGTGGATCTACAATATCAGTCGTGCTGATGAAGGAAAGTACACCTGCTTTGCAGAAAATTACCTTGGCAAAGCCAACAGCACTGGACACCTGTCTGTCAGAGGTAATAAAATCTTATTTTTTTAATTAAATTTTTTTTTTCACATTCATTCACACACATGCACTATGGCCAACTTAGCTTACCCAATTCACCTGTACCGCATGTCTTTAGACTGTGGGGGAAACGGGAGCACCCGGAGGAAACCCATGCAAACATGGGGAGAAAATTCAAACTCCACACAGAAATGCCAACTGACCCAGCCAAGGCTCGAACCAGCCACCTTCTTGCTGTGAGGCGATCGTGCTACCCACTGCGCCACCTTGAGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27783
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 488 853 11 18
ENSDART00000103800 None None 412 None 10
Genomic Location (Zv9):
Chromosome 11 (position 24893257)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23732556
GRCz11 11 23970413
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGGATTTTGTGGATCTACAATATCAGTCGTGCTGATGAAGGAAAGTA[C/A]ACCTGCTTTGCAGAAAATTACCTTGGCAAAGCCAACAGCACTGGACACCT
Long Flanking Sequence:
AAATATAGTTGCATAAACACTGACTGTGTCTTGTTGTGTATGTTAATACACTTTAAACCCCTTTCTGCCAACCCAGCCATGCCTGAACCCCAGTTATAGTATAATCAGTGGTTAAATCCTCTTTGTGTGGTTACCCATTTCCCGTCCTGCCCCGTCCTGTCACCCTCTTTCAGTCCAGGCTCCAGACTTCAGGCTGAATCCAGTACGGAAGCTGGTTCCTGCTGCCCGTGGTGGACAGGTCAAAATGGAGTGTAAACCTCGGGCAGCTCCCAAACCCACTCTCTTCTGGAGCCGCGGCACAGAGTTACTGACTAATAGTACAAGGTAATACAGTAATCAAGTGTTTTAAAGGCCTCCAGATGTCTTGATCGATCAGATAGAGGGGAGCTGTAGATGATTTTAGTAGCAGTATGGTGTGTATGAACTCTCTTCAGGATAACCGTGACTCCGGATGGGATTTTGTGGATCTACAATATCAGTCGTGCTGATGAAGGAAAGTA[C/A]ACCTGCTTTGCAGAAAATTACCTTGGCAAAGCCAACAGCACTGGACACCTGTCTGTCAGAGGTAATAAAATCTTATTTTTTTAATTAAATTTTTTTTTTCACATTCATTCACACACATGCACTATGGCCAACTTAGCTTACCCAATTCACCTGTACCGCATGTCTTTAGACTGTGGGGGAAACGGGAGCACCCGGAGGAAACCCATGCAAACATGGGGAGAAAATTCAAACTCCACACAGAAATGCCAACTGACCCAGCCAAGGCTCGAACCAGCCACCTTCTTGCTGTGAGGCGATCGTGCTACCCACTGCGCCACCTTGAGGCCTTATTATAACAAATTTATATAAAAATGTAACAACGCTCCCAGTATAACTTTCTTTCTTGTATTTATTGACCTGACCTGTACTTATTAAAATGTATGCTAGTGTCATTCAGATCATTTAAATTATAAAACAATTAATTTGGCAAATTGTTTTTACATTTTCAAATCTAGTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41831
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 524 853 12 18
ENSDART00000103800 Nonsense 83 412 4 10
Genomic Location (Zv9):
Chromosome 11 (position 24895113)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23734412
GRCz11 11 23972269
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGATGCCACAAAAATCACACTAGCGCCCTCTAATGCTGATATCAAT[C/T]AGGGTGAAAATGCCACTTTGCAGTGCCATGCATCACATGACCCTACCATG
Long Flanking Sequence:
TCGATTACATGGACTCTAATACACTGATAACTCACAAGATCACCTCACTTAAATAACATGTTGTGCTAGATTACATGCAAACCAATAAGTAAAACCTGTTTGATATATTTTATTAATTTATCAGTTTGATTTCCCCACAGTGATTTTGAAAACAAATCATTTGTATATCTAACAGTTGAGAATTTAATTTGTTATGTTGGTTGTCAAGATAAATAAATATTTACAAACTGAAGAAAAGTACTGTAACACTGGAAAACTTACATCTCATATTCCATCACATTTTGATTGTATCTTCTTGTGCTGCATGTGATAAGAACATGTTTATAAAAAAAGAGTCAAGTAATCATGAAAGAGTCTGCATGTAAACAAATTAAGACCTCTAAAATTATCATTTTAAGTAGTCATCAGCAAGTCATTGATGATACACATTGTTTTTAATTTTGTTCATTCAAACAGATGCCACAAAAATCACACTAGCGCCCTCTAATGCTGATATCAAT[C/T]AGGGTGAAAATGCCACTTTGCAGTGCCATGCATCACATGACCCTACCATGGACCTCACCTTCACCTGGTCACTCAACGGAGTTCCGCTGGACCTAGAGGAACCAAATGGACACTATCGGCGAATGGAGGGGGTGAGCACTTCTTGTCATTTCTCCAGGTGTTGTCCTGAAGAATAGATACAAAAGAAGTTTAAAAGGCTTATTGAACCCCTCTATAGTGTCATTTTTCACCATCAAATTAAAATGACATAATATTTCTGATTCAGCATGTCATGTTTTTTCCATGTTCATACAGGTCAATTTGTTGCAGATGTTTTTTATTTAGACTTATATTTAAACATATCATTTAAGCAGTATTTTTATTATGATTACTATTACATTCAGACTCAAATAATGTTTATTTAGTGTGATTGTAGTATGTGTTCAATGTGTTATTAGTTTAATATCAGCTGACAATGATTTAATAATCATAATGTTTATCCCATTCTTGTGGTCACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21903
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 693 853 15 18
ENSDART00000103800 Nonsense 252 412 7 10
Genomic Location (Zv9):
Chromosome 11 (position 24899036)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23738335
GRCz11 11 23976192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCGGCCCTGGATGGATTATGAGTTCCAGGTCATTGCCAGCAACATCT[T/A]GGGCAGCGGAGAACCAAGCATGCCTTCCCCGCGTGCACAAACCAAAGAAG
Long Flanking Sequence:
TAATTAATGTATTTAATGTATAATATAATATTATTATAATATAATATAGTATAATATAATAGTATTATTATTATTTTATATTTCTTTCTATTTTAATATGGTAATAATATATTAAGATATATTTTATTAATTCTTTTTTTATTCTCTTTTGTTTTGGTATCTTTATATTTTTCTAGTCTATTTTTCATTTATTCACTGTTACAGCCACTTTTCTGAATGATTGAACTAATCATACAATTACATGCATACATGTATTTGCTTGCTTACTTTACCCCATAAACTGCCTAAAGAAAAGCTGCCCAGGACACTTGTTTGAAAAATATAGTAGTATTATGACATCATATATAATGTTACCCTTAGTAATCGAATGCATACCTTTCATTTTGTGCTAATGCTTCCTCCAGACCCTGCAAACATAGAAGGAAATGCTGAATCTGCACGTGTGATAGATCTTCGGCCCTGGATGGATTATGAGTTCCAGGTCATTGCCAGCAACATCT[T/A]GGGCAGCGGAGAACCAAGCATGCCTTCCCCGCGTGCACAAACCAAAGAAGCAGGTCAGGACCGTTACACTTTTATTAGTGCTAAATAAAAATCCAAACAAACCGATGATAAACTATTATTGTGGTTCCAAACAATAACAAACTTGATTGATAGAAGGGTAATATTTTGTGTTACAGCACCAACTGTGGCTCCCAGTGGACTCGGTGGAGGTGGAGGAAACCGTAATGAACTTATTATTACATGGACTGTAAGTTCTATTTGTGTAATTTGATGTTAGAAATGCTTAATACTTTTTACTCTGTCCAGTATTTACACATTTTTCCTTGTGCCCCATGATGCCTAGCATGAATTATAGTTTCAACAATGTTTTAAACAACTGGTTTCAATGAGCTGTCATTTTTCCCCTCAAAGTCCTTCCATTGATTATTAAACTTATTAGAATGAACAAATTGCTTTCAAACCTGAAAAAAAAGTCTTTCTGCAAAAATATTACAGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12173
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000486 Nonsense 775 853 17 18
ENSDART00000103800 Nonsense 334 412 9 10
Genomic Location (Zv9):
Chromosome 11 (position 24900509)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23739808
GRCz11 11 23977665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGGACGGTGGTGAAGGTGCCAAATGTGGAGTCATCTCGATATGTGTA[C/A]AGCAATGACAGTCTGACAGCATACTGCCCGTTCGAGGTCCGAATCAAGGC
Long Flanking Sequence:
GTAGGGAATACAAAGAGAAAATAATCCAGAGAAACAAATACAGTGAACTCAAAACAGCTTTGTCCACAGATAAGTTTGTTACATTAATGTCACATTCAAATAGCAAGCGTAATATTGTTTTCATGACTGTAAGATTAGACTTCGTGCTTTATATTTATCAGAGTATATTGATTATTTTTTGCACAAACTTAATGTTTCAAATGATTTGTTTTAATTCATTTAAATATACGTTCCTCAACCTGGAAGTGCAACCAGTAATTTGAAACACAGTATTCACATTTGGGAAAAAGATGTGTAGAATTGCAAACAGAAGGTCAATAGATGTGTCTTTATTACCCTCAACAAAGAAATTAACATTTCTGCTGGTATGCATCACAGCCCATGGCCAGAGAGTATCAGAATGGAGACAGTTTTGGTTATATCCTGGCATTCAGAAAGCAAGGCATACCAACATGGACGGTGGTGAAGGTGCCAAATGTGGAGTCATCTCGATATGTGTA[C/A]AGCAATGACAGTCTGACAGCATACTGCCCGTTCGAGGTCCGAATCAAGGCCTACAACAAGAAAGGAGAAGGGCCCTTCAGCCAGATTGCTGTAGTACACTCTGCGGAGGAGGGTGAGGGTTATTACTGAGGATTTTATTTTTATGGATATAATTATAGAATTTATTATATTCTGATTGAATGTTACTTAACCCCTAAAGGGCAGACATAGGAGATTACCTAATTAAAAGCTTAAATTGTTTCAAGAAAGCAAAATTATCACATTTATTTAAATGATGTTATTTCTTTTATACTATGAAATGCCATAAAGGTCTATCAATTGACTGGTTAATTTACATTAACTAGATCATTTAAAAAAAAAACACGCACACAAATTTTGATTTAAATGAAATGTTAATGAAATTGTTTTCATTTAAATTGAGAGATTTCTGTATTTCCATTGAAATTATGTTGACCAAAAATGCATGAATCAAGCAACTATTTTTTAAATAATTAAAACAG
Associated Phenotype:
Not determined