Busch Lab

ZMP

zgc:63767

Ensembl ID:
ENSDARG00000000384
ZFIN ID:
ZDB-GENE-040426-1047
Description:
solute carrier family 15 member 4 [Source:RefSeq peptide;Acc:NP_957251]
Human Orthologue:
SLC15A4
Human Description:
solute carrier family 15, member 4 [Source:HGNC Symbol;Acc:23090]
Mouse Orthologue:
Slc15a4
Mouse Description:
solute carrier family 15, member 4 Gene [Source:MGI Symbol;Acc:MGI:2140796]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41259 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18451 Nonsense Available for shipment Available now
sa25401 Nonsense Mutation detected in F1 DNA Not yet available
sa34450 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41259
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Essential Splice Site 114 501 3 10
ENSDART00000076101 None None 240 None 5
ENSDART00000128499 Essential Splice Site 168 428 3 11
Genomic Location (Zv9):
Chromosome 8 (position 37374458)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36230605
GRCz11 8 35959953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTGGGAGCTGTCAAATCAAATATCACTCCATTCGGGGCAGATCAG[G/A]TAATGCAGGGGTGTAAGAGTTGAATTTTGGGGGCCCTCAGAGGGCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18451
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Nonsense 129 501 4 10
ENSDART00000076101 None None 240 None 5
ENSDART00000128499 Nonsense 183 428 4 11
Genomic Location (Zv9):
Chromosome 8 (position 37365219)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36221366
GRCz11 8 35950714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTACAGGYGAARGATCGAGGTCCTGAAGCAACGCGGCGGTTCTTTAACT[G/A]GTTCTACTGGTGCATTAATCTTGGAGCGATCTTCTCTCTGGGTGGTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25401
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Nonsense 254 501 5 10
ENSDART00000076101 Nonsense 43 240 1 5
ENSDART00000128499 Nonsense 308 428 5 11
Genomic Location (Zv9):
Chromosome 8 (position 37359885)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36216032
GRCz11 8 35945380
KASP Assay ID:
554-7854.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCGCTGGTTAAAATACTTCCTGTTTTCCTGGCCCTCATTCCATACTG[G/A]ACTGTCTATTTCCAGGTAAGGCTACTATACATCTTTCAGATCTGTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34450
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Essential Splice Site 259 501 5 10
ENSDART00000076101 Essential Splice Site 48 240 1 5
ENSDART00000128499 Essential Splice Site 313 428 5 11
Genomic Location (Zv9):
Chromosome 8 (position 37359868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36216015
GRCz11 8 35945363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTCCTGTTTTCCTGGCCCTCATTCCATACTGGACTGTCTATTTCCAGG[T/C]AAGGCTACTATACATCTTTCAGATCTGTCAGCTATTAAAAAAAAGGGAGT
Associated Phenotype:
Not determined