Busch Lab

ZMP

si:rp71-1p14.7

Ensembl ID:
ENSDARG00000000349
ZFIN ID:
ZDB-GENE-040724-203
Description:
hypothetical protein LOC497149 [Source:RefSeq peptide;Acc:NP_001070813]
Human Orthologue:
C11orf70
Human Description:
chromosome 11 open reading frame 70 [Source:HGNC Symbol;Acc:28188]
Mouse Orthologue:
9230110C19Rik
Mouse Description:
RIKEN cDNA 9230110C19 gene Gene [Source:MGI Symbol;Acc:MGI:3045346]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13569 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29588
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000361 Nonsense 42 264 2 7
Genomic Location (Zv9):
Chromosome 21 (position 21944795)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22793208
GRCz11 21 22829813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTTTTTGTTAATTATGTTTCCAATTGTCTTTTAGGTCCATGCTGGGT[C/T]GAATTACAGCACAAGCCTTCAACTTTGATCAATCTTTCCAGCCTTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13569
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000361 Nonsense 185 264 5 7
Genomic Location (Zv9):
Chromosome 21 (position 21946963)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22795376
GRCz11 21 22831981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGYMTTGGGTGGTGAACTTTGCCAATATGARGATGTCATCGATCCTTA[C/A]ATTGAGACMGTGAARATAATGTRCAAAGACTTGGTCAGGTGARAAACWGA
Associated Phenotype:
Not determined