Busch Lab

ZMP

si:dkey-75g22.6

Ensembl ID:
ENSDARG00000000324
ZFIN ID:
ZDB-GENE-070912-578
Description:
Novel protein similar to human H326 protein [Source:UniProtKB/TrEMBL;Acc:Q7T134]
Human Orthologues:
DCAF8, DCAF8L1
Human Descriptions:
DDB1 and CUL4 associated factor 8 [Source:HGNC Symbol;Acc:24891]
DDB1 and CUL4 associated factor 8-like 1 [Source:HGNC Symbol;Acc:31810]
Mouse Orthologues:
Dcaf8, Pet2
Mouse Descriptions:
DDB1 and CUL4 associated factor 8 Gene [Source:MGI Symbol;Acc:MGI:91860]
plasmacytoma expressed transcript 2 Gene [Source:MGI Symbol;Acc:MGI:101758]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11916 Essential Splice Site Available for shipment Available now
sa10596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11916
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075913 Essential Splice Site 492 607 9 12
ENSDART00000139564 Essential Splice Site 492 571 10 12
Genomic Location (Zv9):
Chromosome 2 (position 37718536)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38033450
GRCz11 2 38015778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACTCTGCTCGGGTGGTTCAGTTCATGGAGGGAGACCGAGGAGGAGTGG[T/A]AYGAYACTGTCATGTTACTAAGCTAATTATCAAAAGCCATATTTTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10596
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075913 Nonsense 558 607 11 12
ENSDART00000139564 Nonsense 558 571 12 12
Genomic Location (Zv9):
Chromosome 2 (position 37722296)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38037210
GRCz11 2 38019538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGAAGACAACGTTCGTCATGGTGACCAGTATGACACACAGCTCCTCTG[G/A]TTCCTGATGAGACACATGAGAAACCGAAGACCTCAACGGGTWAGAATTTG
Associated Phenotype:
Not determined