Busch Lab

ZMP

slc40a1

Ensembl ID:
ENSDARG00000000241
ZFIN ID:
ZDB-GENE-000511-8
Description:
Solute carrier family 40 member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9R3]
Human Orthologue:
SLC40A1
Human Description:
solute carrier family 40 (iron-regulated transporter), member 1 [Source:HGNC Symbol;Acc:10909]
Mouse Orthologue:
Slc40a1
Mouse Description:
solute carrier family 40 (iron-regulated transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1315

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14190 Nonsense Available for shipment Available now
sa41502 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14190
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000250 Nonsense 114 562 4 8
ENSDART00000128567 Nonsense 114 255 4 7
Genomic Location (Zv9):
Chromosome 9 (position 42178867)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41304037
GRCz11 9 41105824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGTGCTGTCATTCTCTGTGGTGCCCTTTTGATGGCTGTTTTCCAGTTC[A/T]AACAACAGCTTTCTAGCATGTATGATGGATGGTTGCTGGTGAGTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41502
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000250 Nonsense 279 562 7 8
ENSDART00000128567 None None 255 None 7
Genomic Location (Zv9):
Chromosome 9 (position 42182399)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41307569
GRCz11 9 41109356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAACTGATGACTGAAAGCTCCGAGACCAAGAAGGACACCGGCTGCTG[C/A]TACCAAATGGCAGAGCCCATCCGTACCTTTAAAGATGGCTGGGTAGCCTA
Associated Phenotype:
Not determined