Busch Lab

ZMP

thraa

Ensembl ID:
ENSDARG00000000151
ZFIN ID:
ZDB-GENE-990415-263
Description:
Thyroid hormone receptor alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q98867]
Human Orthologue:
THRA
Human Description:
thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) [S
Mouse Orthologue:
Thra
Mouse Description:
thyroid hormone receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98742]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31342 Essential Splice Site Available for shipment Available now
sa25254 Nonsense Mutation detected in F1 DNA Not yet available
sa31341 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31342
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Essential Splice Site 78 427 4 10
ENSDART00000112817 Essential Splice Site 72 466 3 11
Genomic Location (Zv9):
Chromosome 3 (position 34799503)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34584699
GRCz11 3 34714207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAGGCCACTGGCTATCATTACCGCTGCATCACATGTGAGGGCTGCAAG[G/A]TGAGACTTCCAGCGTCTGAAGCGCTTGACTCGTGATAAATCTGTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25254
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Nonsense 97 427 5 10
ENSDART00000112817 Nonsense 91 466 4 11
Genomic Location (Zv9):
Chromosome 3 (position 34799359)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34584555
GRCz11 3 34714063
KASP Assay ID:
554-7658.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGGACAATACAGAAAAACCTTCATCCGTCCTATTCCTGTAAATA[T/G]GACAGCTGCTGCATCATTGACAAAATCACCCGCAACCAGTGCCAGCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000160 Nonsense 367 427 9 10
ENSDART00000112817 Nonsense 361 466 8 11
Genomic Location (Zv9):
Chromosome 3 (position 34786727)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34571923
GRCz11 3 34701431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTCGAGCACTACATCAACCACCGCAAGCACAACATCTCCCACTTCTG[G/A]CCCAAGCTGCTGATGAAGGTGACGAACCTGCGCATGATCGGCGCCTGCCA
Associated Phenotype:
Not determined