Busch Lab

ZMP

NP_956202.1

Ensembl ID:
ENSDARG00000000102
Description:
skeletal muscle receptor tyrosine kinase isoform 1 [Source:RefSeq peptide;Acc:NP_001004503]
Human Orthologue:
MUSK
Human Description:
muscle, skeletal, receptor tyrosine kinase [Source:HGNC Symbol;Acc:7525]
Mouse Orthologue:
Musk
Mouse Description:
muscle, skeletal, receptor tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:103581]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa41605 Nonsense Mutation detected in F1 DNA Not yet available
sa41604 Nonsense Mutation detected in F1 DNA Not yet available
sa17664 Nonsense Available for shipment Available now
sa34861 Nonsense Mutation detected in F1 DNA Not yet available
sa41603 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1030 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4363
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 159 941 4 18
ENSDART00000064922 Nonsense 159 941 4 17
ENSDART00000111076 Nonsense 159 351 4 6
Genomic Location (Zv9):
Chromosome 10 (position 13108130)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13186221
GRCz11 10 13144340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGGTTWTCCCAAACCTGAAATATCCTGGATAAAAGAAGATGATTTGATC[A/T]AGGTAAATAAAAAGACTTGTCTTGCCATTTAACATATCTTCCAAGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41605
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 216 941 6 18
ENSDART00000064922 Nonsense 216 941 6 17
ENSDART00000111076 Nonsense 216 351 6 6
Genomic Location (Zv9):
Chromosome 10 (position 13105786)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13183877
GRCz11 10 13141996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTCCCTGACTTTCCTAAAGCTCCTGCCAAGATACTGAAAGTTCCC[A/T]AGGAAAAGCGAGTTCAGATTGGATCAGAGGTCACATTAGAGTGCAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41604
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 None None 941 None 18
ENSDART00000064922 None None 941 None 17
ENSDART00000111076 Nonsense 280 351 6 6
Genomic Location (Zv9):
Chromosome 10 (position 13105593)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13183684
GRCz11 10 13141803
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCATTCCCTTCTTTTCCTCTTGCTTGCTTTGGCCCTGCAGAGAAAAT[T/A]AATCGTACTTTCTTCTCATCTTACTGGAACAGAGAGCAGAGCACAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17664
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 268 941 7 18
ENSDART00000064922 Nonsense 268 941 7 17
ENSDART00000111076 None None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13087274)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13165365
GRCz11 10 13123484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCATCTGTGGTGGAGACACTGGTGGGGRAAGTTATACTGTCAGTTCTG[C/T]AAGTGGTKGTCCATAAACCAGCACTCTACACCTKTCAGGCTACTAATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 483 941 12 18
ENSDART00000064922 Nonsense 483 941 11 17
ENSDART00000111076 None None 351 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 13060329)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13138420
GRCz11 10 13096539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACACACAATGTCACAGCATCGTCCATTCCATGTCAGCGATGGAACCAG[C/T]AGGTAAATGTTTGTACTGCAAAAGTCAGCATAAAATCACAAAGTTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41603
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Essential Splice Site 599 941 16 18
ENSDART00000064922 Essential Splice Site 599 941 15 17
ENSDART00000111076 None None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13050948)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13129140
GRCz11 10 13087259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGTTTTAACTAAATACCTCAAAACTAAACAGTTGTTCTTCCATATTC[A/G]GTAGGGTGCTGGAGACACCTACATTGACCACCCTCCCCTCAGAGCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1030
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000102 Nonsense 779 941 18 18
ENSDART00000064922 Nonsense 779 941 17 17
ENSDART00000111076 None None 351 None 6
Genomic Location (Zv9):
Chromosome 10 (position 13049154)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13127346
GRCz11 10 13085465
KASP Assay ID:
554-0934.1 (used for ordering genotyping assays)
KASP Sequence:
AACCTGAGCGTTACCCACCCCTCAGCTGCCAGGAGCAGCTCTCCATTTCC[A/T]AACAGGTGGCAGCAGGAATGGCGTACTTATCGGAGCGCAAATTTGTCCAC
Associated Phenotype:
Not determined